LXL04_010307 | RubberDandelionOmics

Gene overview

LXL04_010307

Reference: OH-1004 Chr: Chr02 Coordinates: 143951153-143954634 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1320 bp · LXL04_010307|LXL04_010307|OH1004|cDNA

ATGCTAAGCGATCTTTATTCTGACTCAGATGAATATGGAAGTGAGAGTGAAGAGGTTAGCGATGAGTATTATGAAGAGGATGACGATGTGGATGTTGAAAATAGATCTGAGCGTTCTTGTTCATATGAAGATTCAGAAAGTGTTAGTTATAGTGAGAGTGGAGATGACGATCACAGCAAGGGCTCCGTTAGCTCAAATTCGGTGTCCATTGAAGCTAGTGATGATGGAGAAGATGAAGAGTTCATTACCAGGAAACACAC...

CDS

Download CDS FASTA

1320 bp · LXL04_010307|LXL04_010307|OH1004|CDS

ATGCTAAGCGATCTTTATTCTGACTCAGATGAATATGGAAGTGAGAGTGAAGAGGTTAGCGATGAGTATTATGAAGAGGATGACGATGTGGATGTTGAAAATAGATCTGAGCGTTCTTGTTCATATGAAGATTCAGAAAGTGTTAGTTATAGTGAGAGTGGAGATGACGATCACAGCAAGGGCTCCGTTAGCTCAAATTCGGTGTCCATTGAAGCTAGTGATGATGGAGAAGATGAAGAGTTCATTACCAGGAAACACAC...

Protein

Download Protein FASTA

439 aa · LXL04_010307|LXL04_010307|OH1004|PROTEIN

MLSDLYSDSDEYGSESEEVSDEYYEEDDDVDVENRSERSCSYEDSESVSYSESGDDDHSKGSVSSNSVSIEASDDGEDEEFITRKHTRTTIKKGSRLENIDLVIEQQAEILRLEAMKIKLKERIEAEVTIYLNQRQRHETAWQLAYRPNLLSGKYLTSYHYFAYPPKTMANISEVVSRLSMKVAIITGGAQGIGEATARLFIKHGAKVVIADIQDQLGESVCKDMGIDNASFVHCDVTIESDVENAINVTLAKYGRLDIM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010307`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010307

Location Chr02:143951153-143954634 (-)

Description Similar to Secoisolariciresinol dehydrogenase (Fragment)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51680`	Short-chain dehydrogenase reductase 2a.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010307 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009688 abscisic acid biosynthetic process Biological Process

GO:0009807 lignan biosynthetic process Biological Process

GO:0016099 monoterpenoid biosynthetic process Biological Process

GO:0044283 small molecule biosynthetic process Biological Process

GO:0046211 (+)-camphor biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0010301 xanthoxin dehydrogenase (NAD+) activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function

GO:0047500 (+)-borneol dehydrogenase activity Molecular Function

KEGG gene cross-reference

ag:BAK09296

ath:AT3G51680

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.610

Rank 1 · LXL04_010307 · OH-1004

Nucleus0.470

Rank 2 · LXL04_010307 · OH-1004

Mitochondrion0.049

Rank 3 · LXL04_010307 · OH-1004

Peroxisome0.046

Rank 4 · LXL04_010307 · OH-1004

Cell membrane0.038

Rank 5 · LXL04_010307 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106.32adh_short182-373 aa

PF08659.17KR185-340 aa

PF13561.13adh_short_C2190-423 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010307	`PF00106.32`	adh_short	182	373	1.6e-52	178.6
LXL04_010307	`PF08659.17`	KR	185	340	7.1e-09	36.6
LXL04_010307	`PF13561.13`	adh_short_C2	190	423	3.6e-62	210.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SCU0`	Arabidopsis thaliana	Short-chain dehydrogenase reductase 2a	52.015%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card