TkA03G516290 | RubberDandelionOmics

Gene overview

TkA03G516290

Reference: TK1151 Chr: Chr03 Coordinates: 129542681-129544102 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1422 bp · TkA03G516290|TK1151|cDNA

ATGGTGATGAGAAGCAAAGCAATCATCAAATGGCCGAAGCAAGTAACAACATCTCTAGTCGAGCAACTGATTAAATCCGAACGAAACGTAGAAAAAGCTCTCACCGTCTTCGATTCCGCATCGGCAGAGTACGCCAATGGCTTCCGCCATGACCACACCACCTACTCCCTCATCATCTCAAAGCTCTTATCCGTAAACCAATTCAAAAGAGCAGAAGACTTCATCGACAGAATGAAAACAGAAAACTGCAAAATCACCGA...

CDS

Download CDS FASTA

1422 bp · TkA03G516290|TK1151|CDS

ATGGTGATGAGAAGCAAAGCAATCATCAAATGGCCGAAGCAAGTAACAACATCTCTAGTCGAGCAACTGATTAAATCCGAACGAAACGTAGAAAAAGCTCTCACCGTCTTCGATTCCGCATCGGCAGAGTACGCCAATGGCTTCCGCCATGACCACACCACCTACTCCCTCATCATCTCAAAGCTCTTATCCGTAAACCAATTCAAAAGAGCAGAAGACTTCATCGACAGAATGAAAACAGAAAACTGCAAAATCACCGA...

Protein

Download Protein FASTA

473 aa · TkA03G516290|TK1151|PROTEIN

MVMRSKAIIKWPKQVTTSLVEQLIKSERNVEKALTVFDSASAEYANGFRHDHTTYSLIISKLLSVNQFKRAEDFIDRMKTENCKITEDILLSICRAYGRVHKPHDVMRIFQKISDPTIKAYVTVFSILVDENQLKVAFKFYRYMRQLGFPPSVPSLNVLIKALSKNESTMDSAIKILREMPKHGCTPDTYTYGTLINGLCKLSKIKEAKDLFKEMETKGCSPSVVTYTSLIHGLSQSNNLNESMSLFKEMESKNITPNVY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G516290`
TK1151 ID	TkA03G516290
OH-1004 ID	LXL04_010266
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 91.121 / OH-1004 87.780 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G516290

Location Chr03:129542681-129544102 (+)

Description Similar to At5g46100: Pentatricopeptide repeat-containing protein At5g46100

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g46100`	Pentatricopeptide repeat-containing protein At5g46100.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010266 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000963 mitochondrial RNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G48810

ath:AT4G20090

ath:AT5G46100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.864

Rank 1 · TkA03G516290 · TK1151

Nucleus0.057

Rank 2 · TkA03G516290 · TK1151

Plastid0.055

Rank 3 · TkA03G516290 · TK1151

Cytoplasm0.039

Rank 4 · TkA03G516290 · TK1151

Cell membrane0.011

Rank 5 · TkA03G516290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23276TPR_2410-112 aa

PF10363RTP1_C111-35 aa

PF29070MSC6_N12-120 aa

PF10037MRP-S2714-72 aa

PF13041PPR_219-38 aa

PF01535PPR27-38 aa

PF17177PPR_long28-82 aa

PF12854PPR_129-38 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G516290	`PF23276`	TPR_24	10	112	2.6e-26	92.8
TkA03G516290	`PF10363`	RTP1_C1	11	35	0.12	13.2
TkA03G516290	`PF29070`	MSC6_N	12	120	2.1e-23	83.8
TkA03G516290	`PF10037`	MRP-S27	14	72	0.1	12.3
TkA03G516290	`PF13041`	PPR_2	19	38	1.2e-81	269.4
TkA03G516290	`PF01535`	PPR	27	38	6.2e-55	180.4
TkA03G516290	`PF17177`	PPR_long	28	82	2e-25	90.2
TkA03G516290	`PF12854`	PPR_1	29	38	3.1e-62	206.7
TkA03G516290	`PF13812`	PPR_3	46	84	2.5e-42	143.5
TkA03G516290	`PF28774`	DUF8457	48	82	0.47	11.5
TkA03G516290	`PF12854`	PPR_1	49	79	3.1e-62	206.7
TkA03G516290	`PF13041`	PPR_2	51	86	1.2e-81	269.4
TkA03G516290	`PF01535`	PPR	54	83	6.2e-55	180.4
TkA03G516290	`PF24760`	TPR_IF140_C	54	79	0.00063	20.9
TkA03G516290	`PF25569`	TPR_ZFYVE26	54	119	1.4	9.9
TkA03G516290	`PF29978`	ATP18_TPR	57	84	0.008	16.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FNL2`	Arabidopsis thaliana	sp\|Q9FNL2\|PP418_ARATH Pentatricopeptide repeat-containing protein At5g46100	65.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card