TkA03G508270 | RubberDandelionOmics

Gene overview

TkA03G508270

Reference: TK1151 Chr: Chr03 Coordinates: 127400243-127402356 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1209 bp · TkA03G508270|TK1151|cDNA

AGAAAATCTAAAATCAGAAAACAAGAAACAAGAAACAAAAAAAACACTGCGCCTACATTTATCTTTGTCCCTTCAGAATCGGTGCCGTGAGTAATTTGAAAATCCTCTCCCCCACCGGCGACTATGAAAGCTGTAGTGATCACAACTCCGGGAGGTCCAGAAGTTCTGAAACTGCTAGAAGTAGAAGAGCCTAAACTCACAGACAATGAAGTATTGATCAGAGTGGAAGCCACGGCTCTTAACAGAGCTGATACGCTTCA...

CDS

Download CDS FASTA

978 bp · TkA03G508270|TK1151|CDS

ATGAAAGCTGTAGTGATCACAACTCCGGGAGGTCCAGAAGTTCTGAAACTGCTAGAAGTAGAAGAGCCTAAACTCACAGACAATGAAGTATTGATCAGAGTGGAAGCCACGGCTCTTAACAGAGCTGATACGCTTCAACGCCAAGGAAAGTACCCTCCGCCAAAAGGCGACAGTGAATATCCAGGTCTAGAGTGTTCCGGAACCATCGAACAAGTAGGCAAAAACGTATCTCGTTGGAAAATTGGGGACCAGGTATGTGC...

Protein

Download Protein FASTA

325 aa · TkA03G508270|TK1151|PROTEIN

MKAVVITTPGGPEVLKLLEVEEPKLTDNEVLIRVEATALNRADTLQRQGKYPPPKGDSEYPGLECSGTIEQVGKNVSRWKIGDQVCALISGGGYAEKVAVPAGQVLPIPSGVSLKDAASFPEVACTVWSTVFMTSKLSSGETFLIHGGSSGIGTFAIQMAKYLGVKVFVTAGSEEKLKACKELGADVCINYKTEDFVARVKEETGGKGVDVILDNIGGAYFQKNLESLGMDGRLFIIGFMGGVKAEANISFLLAKRLTVQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G508270`
TK1151 ID	TkA03G508270
OH-1004 ID	LXL04_010155
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G508270`
Location	Chr03:127400243-127402356 (-)
Description	Similar to TP53I3: Quinone oxidoreductase PIG3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_010155` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0042178 xenobiotic catabolic process Biological Process GO:0048255 mRNA stabilization Biological Process GO:0051289 protein homotetramerization Biological Process GO:1901662 quinone catabolic process Biological Process GO:1903409 reactive oxygen species biosynthetic process Biological Process GO:0005829 cytosol Cellular Component GO:0003730 mRNA 3'-UTR binding Molecular Function GO:0003960 quinone reductase (NADPH) activity Molecular Function GO:0008270 zinc ion binding Molecular Function GO:0016651 oxidoreductase activity, acting on NAD(P)H Molecular Function GO:0042802 identical protein binding Molecular Function GO:0050661 NADP binding Molecular Function
KEGG gene cross-reference	cpoc:100135507 hsa:9540 mmu:12972 rno:362061 vda:VDAG_08652 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.472

Rank 1 · TkA03G508270 · TK1151

Cytoplasm0.401

Rank 2 · TkA03G508270 · TK1151

Nucleus0.124

Rank 3 · TkA03G508270 · TK1151

Peroxisome0.103

Rank 4 · TkA03G508270 · TK1151

Cell membrane0.095

Rank 5 · TkA03G508270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26370KDD_N22-42 aa

PF08240ADH_N27-109 aa

PF26370KDD_N44-90 aa

PF08123DOT1121-169 aa

PF01262AlaDh_PNT_C139-198 aa

PF00106adh_short143-222 aa

PF00107ADH_zinc_N151-266 aa

PF13602ADH_zinc_N_2183-323 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G508270	`PF26370`	KDD_N	22	42	0.12	12.8
TkA03G508270	`PF08240`	ADH_N	27	109	6.5e-18	65.6
TkA03G508270	`PF26370`	KDD_N	44	90	0.12	12.8
TkA03G508270	`PF08123`	DOT1	121	169	0.19	12.0
TkA03G508270	`PF01262`	AlaDh_PNT_C	139	198	0.037	14.2
TkA03G508270	`PF00106`	adh_short	143	222	0.00029	21.1
TkA03G508270	`PF00107`	ADH_zinc_N	151	266	7.2e-33	114.0
TkA03G508270	`PF13602`	ADH_zinc_N_2	183	323	4.8e-25	89.7
TkA03G508270	`PF00106`	adh_short	252	282	0.00029	21.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card