TkA03G494440 | RubberDandelionOmics

Gene overview

TkA03G494440

Reference: TK1151 Chr: Chr03 Coordinates: 124054125-124056424 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1071 bp · TkA03G494440|TK1151|cDNA

GTTGGTTTCTATGCCAAAGGTGGAATTACATGCTCACCTTAATGGTTCCATAAGAAATTCAACTCTACTATGATGAAATTGTGATAGAAGAAATTATCGCACCTACACACACGCTAAAGGGTTTTAATGCCTCAGAACATAGGAAAATCATTGCTTTACATTTCTGAGAACTTGCTAGAGAATTGGGGGAGAAGGGAACCATTATCTTCTCTGATTTCGAACATGTTATCAAGAAAAACGATCGATCACTACGTGAAGTC...

CDS

Download CDS FASTA

549 bp · TkA03G494440|TK1151|CDS

ATGAGTAAGCGGTCATACATGGAAGCTGTTGTGGAAGGTCTAAGATCCGTGAGTAGTCTTGATATCAACTTTTGTTGTGATGATATCGAGAAATGTTCTTCAGATAGAATTGAAAAGAAGAAGATTTTTGTTAGACTTTTACTCAGTATTGATAGGCGTGAATCTAGTGAAGCTGCAATGGAAACCGTTAAACTTGCTATGGAAATGAGGGACGCTGGTGTTGTTGGCATTGATCTTTCTGGGAATCCAACGGTTGGTGA...

Protein

Download Protein FASTA

182 aa · TkA03G494440|TK1151|PROTEIN

MSKRSYMEAVVEGLRSVSSLDINFCCDDIEKCSSDRIEKKKIFVRLLLSIDRRESSEAAMETVKLAMEMRDAGVVGIDLSGNPTVGEWATFFPALKSAREHGLSVTLHCGEVPNSVEIQEMLDFLPGRIGHACCFQDQEWRKLKSSKIPVEICLTSNIRTETISSVDVHHFGQFFFLIRKIR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G494440`
TK1151 ID	TkA03G494440
OH-1004 ID	LXL04_010076
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 54.491 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G494440

Location Chr03:124054125-124056424 (-)

Description Similar to MAPDA: N6-mAMP deaminase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g04880`	May act as a deaminase in detoxification of adenosine derivatives bearing N6-methyladenine modifications.	m 6 A RNA Degradation Products Are Catabolized by an Evolutionarily Conserved N 6 -Methyl-AMP Deaminase in Plant and Mammalian Cells.2018 · DOI: 10.1105/tpc.18.00236 Alternative conformation induced by substrate binding for Arabidopsis thalianaN6-methyl-AMP deaminase.2019 · DOI: 10.1093/nar/gkz070 Structure of Arabidopsis thaliana N 6 -methyl-AMP deaminase ADAL with bound GMP and IMP and implications for N 6 -methyl-AMP recognition and processing.2019 · DOI: 10.1080/15476286.2019.1642712

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010076 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006154 adenosine catabolic process Biological Process

GO:0006401 RNA catabolic process Biological Process

GO:0009117 nucleotide metabolic process Biological Process

GO:0046103 inosine biosynthetic process Biological Process

GO:0110052 toxic metabolite repair Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004000 adenosine deaminase activity Molecular Function

GO:0019239 deaminase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0062154 N6-methyl-AMP deaminase activity Molecular Function

KEGG gene cross-reference

ath:AT4G04880

bta:512667

hsa:161823

mmu:75894

xla:443687

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.458

Rank 1 · TkA03G494440 · TK1151

Nucleus0.363

Rank 2 · TkA03G494440 · TK1151

Mitochondrion0.155

Rank 3 · TkA03G494440 · TK1151

Plastid0.103

Rank 4 · TkA03G494440 · TK1151

Peroxisome0.077

Rank 5 · TkA03G494440 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00962A_deaminase20-175 aa

PF21874CofJ25-92 aa

PF04909Amidohydro_267-126 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G494440	`PF00962`	A_deaminase	20	175	5.9e-21	75.6
TkA03G494440	`PF21874`	CofJ	25	92	0.18	11.8
TkA03G494440	`PF04909`	Amidohydro_2	67	126	0.015	15.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LPL7`	Arabidopsis thaliana	sp\|Q8LPL7\|ADAL_ARATH N6-mAMP deaminase	68.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card