RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G488900
Reference: TK1151 Chr: Chr03 Coordinates: 122548059-122552951 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2568 bp · TkA03G488900|TK1151|cDNA

AGGAGATCGGTGCACAAATATTTATTTAGAAGGAATGGAAAAGAATCAAAACGGAAGACGCCCGCATAACGTGGTCATTTTCCACCCATACACGCACACAGACACATCGCACACACTCTCAGAAGAAGCGTTACAACGGTGAGCCATTGACATCTTCACACTCCTTTAATTTAGAGAGAGAAAATGTGCTCGTAGACTCTCAGAGAGACCCAATTGTATGGCTATGGGAGGTGGTTCAGTAGGAGGAGTGATTGTGCCGT...

CDS

Download CDS FASTA

2025 bp · TkA03G488900|TK1151|CDS

ATGGCTATGGGAGGTGGTTCAGTAGGAGGAGTGATTGTGCCGTCGGTGAAGTCGGAACCGCCTGAACCTTCAACGGAGGGACTCGCATCTTCGTCTCCACCACTTCCGGTGGCTCAGGAACCTCAGTTGCAGCTTCCGGCGCCAGATTCCGCTGTGGCCGTGGTGGAGATGGAGGCAAGGGGAAATGATCGTGAGGTGTTGGATGCGGCAGCGCTGGATAAAGATGTGTTGTGTCCGATATGCATGCAGATCATTAAGGA...

Protein

Download Protein FASTA

674 aa · TkA03G488900|TK1151|PROTEIN

MAMGGGSVGGVIVPSVKSEPPEPSTEGLASSSPPLPVAQEPQLQLPAPDSAVAVVEMEARGNDREVLDAAALDKDVLCPICMQIIKDAFLTSCGHNFCYMCIATHLQNKSDCPCCSQYLTTNQIFPNFLLNKLLMKTSACQIAKGASPVEQVRLAFQQGCDVSIKDLDSLIGVLTDKKKIMEQEEAESNLQIMHEFLYCLRRQKLEELNEIQKDLGYIKEDINAVERHRIELHRARERCSVKLRILTDDSTVKTSWPSLM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G488900
TK1151 IDTkA03G488900
OH-1004 IDLXL04_010005
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G488900
LocationChr03:122548059-122552951 (-)
DescriptionSimilar to COP1: E3 ubiquitin-protein ligase COP1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g32950 E3 ubiquitin-protein ligase that acts as a repressor of photomorphogenesis and as an activator of etiolation in darkness.
Two interacting bZIP proteins are direct targets of COP1-mediated control of light-dependent gene expression in Arabidopsis.2002 · DOI: 10.1101/gad.969702
Short Hypocotyl in White Light1 Interacts with Elongated Hypocotyl5 (HY5) and Constitutive Photomorphogenic1 (COP1) and Promotes COP1-Mediated Degradation of HY5 during Arabidopsis Seedling Development.2015 · DOI: 10.1104/pp.15.01184
PHYTOCHROME INTERACTING FACTOR8 Inhibits Phytochrome A-Mediated Far-Red Light Responses in Arabidopsis.2020 · DOI: 10.1105/tpc.19.00515
Role of a COP1 interactive protein in mediating light-regulated gene expression in arabidopsis.1998 · DOI: 10.1105/tpc.10.7.1083
At1g53090 Repressor of photomorphogenesis in the light.
The SPA1-like proteins SPA3 and SPA4 repress photomorphogenesis in the light.2003 · DOI: 10.1046/j.1365-313x.2003.01813.x
Functional and expression analysis of Arabidopsis SPA genes during seedling photomorphogenesis and adult growth.2006 · DOI: 10.1111/j.1365-313x.2006.02812.x
Arabidopsis SPA proteins regulate photoperiodic flowering and interact with the floral inducer CONSTANS to regulate its stability.2006 · DOI: 10.1242/dev.02481

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_010005 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006281 DNA repair Biological Process
GO:0006511 ubiquitin-dependent protein catabolic process Biological Process
GO:0009585 red, far-red light phototransduction Biological Process
GO:0009640 photomorphogenesis Biological Process
GO:0009641 shade avoidance Biological Process
GO:0009647 skotomorphogenesis Biological Process
GO:0009649 entrainment of circadian clock Biological Process
GO:0009963 positive regulation of flavonoid biosynthetic process Biological Process
GO:0010119 regulation of stomatal movement Biological Process
GO:0010212 response to ionizing radiation Biological Process
GO:0010224 response to UV-B Biological Process
GO:0016567 protein ubiquitination Biological Process
KEGG gene cross-reference
ath:AT2G32950
ath:AT3G15354
hsa:64326
mmu:26374
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.706
Rank 1 · TkA03G488900 · TK1151
Cytoplasm0.310
Rank 2 · TkA03G488900 · TK1151
Cell membrane0.041
Rank 3 · TkA03G488900 · TK1151
Mitochondrion0.036
Rank 4 · TkA03G488900 · TK1151
Lysosome / Vacuole0.032
Rank 5 · TkA03G488900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14835zf-RING_670-116 aa
PF13920zf-C3HC4_375-119 aa
PF11789zf-Nse75-116 aa
PF18279zf-WRNIP1_ubi76-90 aa
PF04564U-box77-130 aa
PF24921RING_XB3-XBAT3177-111 aa
PF16685zf-RING_1077-119 aa
PF13923zf-C3HC4_278-115 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G488900PF14835zf-RING_6701160.05614.0
TkA03G488900PF13920zf-C3HC4_3751197.2e-0729.6
TkA03G488900PF11789zf-Nse751162.09.0
TkA03G488900PF18279zf-WRNIP1_ubi76906.28.4
TkA03G488900PF04564U-box771300.002218.8
TkA03G488900PF24921RING_XB3-XBAT31771110.01815.8
TkA03G488900PF16685zf-RING_10771190.02315.5
TkA03G488900PF13923zf-C3HC4_2781152.7e-1040.6
TkA03G488900PF00097zf-C3HC4781153.3e-0834.0
TkA03G488900PF13639zf-RING_2781154.7e-0627.5
TkA03G488900PF15227zf-C3HC4_4781156.5e-0523.7
TkA03G488900PF13445zf-RING_UBOX781139.7e-0523.0
TkA03G488900PF14634zf-RING_5781170.005217.4
TkA03G488900PF14447Prok-RING_4781200.2811.8
TkA03G488900PF12861zf-ANAPC11781215.27.9
TkA03G488900PF12678zf-rbx1791150.3311.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
P43254Arabidopsis thalianasp|P43254|COP1_ARATH E3 ubiquitin-protein ligase COP170.800%Swiss-ProtHigh
Q94BM7Arabidopsis thalianasp|Q94BM7|SPA4_ARATH Protein SPA1-RELATED 448.700%Swiss-ProtLow

JBrowse

View in Genome Browser