TkA03G474370 | RubberDandelionOmics

Gene overview

TkA03G474370

Reference: TK1151 Chr: Chr03 Coordinates: 118599481-118603516 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2085 bp · TkA03G474370|TK1151|cDNA

ACAGGAAATTGCAGAGCTTAAACAGAGACAGTGGTGGTTGCCTGCCATGGTTGTTCTAGAGAAAAACCCTAATTCCAAAGCTGAAAATGGCGATGGCTCCAACAGCAAGAAGAAACGAAAGAGGAACAAGAACAAGAAGAACAATGTAGAGGAAGAGCCTGACATGGCTGCACAAGAACCATCAGAAATCAATGGCAGTGAGAAGGAAGAGGAATAAGTCACCACAGTGAAAGAATCGAAAAGGACGAGAAAGAAGAAAG...

CDS

Download CDS FASTA

966 bp · TkA03G474370|TK1151|CDS

ATGAAACAGATAAGTAAAATCTTACCCAAGACTAGGCAAACTGCTCTGTTTTCTGCAACTCAGACAAAGAAGGTTGAGGATCTTGCACGACTATCATTTCAAACTACTCCAGTCTACATTGATGTAGATGATGGGAGGTCAAGAGTGACAAATGAAGGATTGCAACAAGGGTACTGTGTGGTCCCAAGTACAAAGAGATTCCTACTTCTCTACTCTTTCTTAAAAAGAAACATTTCAAAGAAAGTCATGGTTTTCTTTTC...

Protein

Download Protein FASTA

321 aa · TkA03G474370|TK1151|PROTEIN

MKQISKILPKTRQTALFSATQTKKVEDLARLSFQTTPVYIDVDDGRSRVTNEGLQQGYCVVPSTKRFLLLYSFLKRNISKKVMVFFSSCNSVKFHSELLKYIQVDCFDIHGKQKQQKRTSTFFDYCKAEKGILLCTDVAARGLDIPAVDWIVQYDPPDEPKEYIHRVGRTARGEGAKGNALLFLIPEELQFLRYLKAAKVPVKEYEFDEKKMANVQSHLEKLVANNYYLNKSAKDAYRSYLLAYNSHSMKDIFNVHLLDM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G474370`
TK1151 ID	TkA03G474370
OH-1004 ID	LXL04_035508
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 50.952 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G474370

Location Chr03:118599481-118603516 (-)

Description Similar to Os03g0802700: DEAD-box ATP-dependent RNA helicase 27

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g18600`	DEAD-box ATP-dependent RNA helicase 51.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0802700`	DEAD-box ATP-dependent RNA helicase 27.	No verified direct reference in this release
`Os06g0535100`	Putative DEAD-box ATP-dependent RNA helicase 51.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035508 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000463 maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process

GO:0048866 stem cell fate specification Biological Process

GO:0005634 nucleus Cellular Component

GO:0005694 chromosome Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003724 RNA helicase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

KEGG gene cross-reference

ath:AT3G18600

ath:AT5G65900

ddi:DDB_G0282741

dosa:Os03g0802700

dosa:Os06g0535100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.881

Rank 1 · TkA03G474370 · TK1151

Cytoplasm0.170

Rank 2 · TkA03G474370 · TK1151

Mitochondrion0.036

Rank 3 · TkA03G474370 · TK1151

Cell membrane0.019

Rank 4 · TkA03G474370 · TK1151

Golgi apparatus0.011

Rank 5 · TkA03G474370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00271Helicase_C10-29 aa

PF00271Helicase_C69-172 aa

PF13307Helicase_C_277-146 aa

PF13959CTE_SPB4226-275 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G474370	`PF00271`	Helicase_C	10	29	6.9e-25	88.2
TkA03G474370	`PF00271`	Helicase_C	69	172	6.9e-25	88.2
TkA03G474370	`PF13307`	Helicase_C_2	77	146	0.096	13.4
TkA03G474370	`PF13959`	CTE_SPB4	226	275	1.7e-17	63.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LIH9`	Arabidopsis thaliana	sp\|Q9LIH9\|RH51_ARATH DEAD-box ATP-dependent RNA helicase 51	74.300%	Swiss-Prot	High
`Q84T03`	Oryza sativa subsp. japonica	sp\|Q84T03\|RH27_ORYSJ DEAD-box ATP-dependent RNA helicase 27	66.700%	Swiss-Prot	High
`Q0DBS1`	Oryza sativa subsp. japonica	sp\|Q0DBS1\|RH51_ORYSJ Putative DEAD-box ATP-dependent RNA helicase 51	61.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card