TkA03G463810 | RubberDandelionOmics

Gene overview

TkA03G463810

Reference: TK1151 Chr: Chr03 Coordinates: 115806764-115807117 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

354 bp · TkA03G463810|TK1151|cDNA

ATGGCAAGAAAATGGCGTAGAGAGGCGGCCAAGAGTGCTGCAAGGGTGGCCGACAAGGGTCATTTTGTTGTTTACACGGTGGATCATAGTCGTTTTGTGATTCCGTTGCATTATCTCAACAACAATATATTTCGTGAGCTTTTGAAGATGTCCGAGGATGAGTTTGGGTTGCCAACAAACAGGCCTATAACTTTGCCTTGTGACTCAAGCCTCATGAACTATTTAGTGAGTGTCTTTGAACGATCTCCGACCAAAGATCT...

CDS

Download CDS FASTA

354 bp · TkA03G463810|TK1151|CDS

ATGGCAAGAAAATGGCGTAGAGAGGCGGCCAAGAGTGCTGCAAGGGTGGCCGACAAGGGTCATTTTGTTGTTTACACGGTGGATCATAGTCGTTTTGTGATTCCGTTGCATTATCTCAACAACAATATATTTCGTGAGCTTTTGAAGATGTCCGAGGATGAGTTTGGGTTGCCAACAAACAGGCCTATAACTTTGCCTTGTGACTCAAGCCTCATGAACTATTTAGTGAGTGTCTTTGAACGATCTCCGACCAAAGATCT...

Protein

Download Protein FASTA

117 aa · TkA03G463810|TK1151|PROTEIN

MARKWRREAAKSAARVADKGHFVVYTVDHSRFVIPLHYLNNNIFRELLKMSEDEFGLPTNRPITLPCDSSLMNYLVSVFERSPTKDLEALLISIATNRCSSIDQGGENRKQVLVYGF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G463810`
TK1151 ID	TkA03G463810
OH-1004 ID	LXL04_023861
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 92.857 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G463810

Location Chr03:115806764-115807117 (-)

Description Similar to SAUR64: Auxin-responsive protein SAUR64

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29450`	May promote auxin-stimulated organ elongation, such as hypocotyls, stamen filaments and petals.	No verified direct reference in this release
`At1g29500`	May promote auxin-stimulated organ elongation, such as hypocotyls, stamen filaments and petals.	No verified direct reference in this release
`At1g29440`	May promote auxin-stimulated organ elongation, such as hypocotyls, stamen filaments and petals.	Arabidopsis SMALL AUXIN UP RNA63 promotes hypocotyl and stamen filament elongation.2012 · DOI: 10.1111/j.1365-313x.2012.05024.x
`At1g29510`	May promote auxin-stimulated organ elongation, such as hypocotyls, stamen filaments and petals.	No verified direct reference in this release
`At1g29460`	May promote auxin-stimulated organ elongation, such as hypocotyls, stamen filaments and petals.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023861 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009926 auxin polar transport Biological Process

GO:0042255 ribosome assembly Biological Process

GO:0080086 stamen filament development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0090406 pollen tube Cellular Component

KEGG gene cross-reference

ath:AT1G29420

ath:AT1G29430

ath:AT1G29450

ath:AT1G29460

ath:AT1G29500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.541

Rank 1 · TkA03G463810 · TK1151

Nucleus0.344

Rank 2 · TkA03G463810 · TK1151

Cell membrane0.182

Rank 3 · TkA03G463810 · TK1151

Endoplasmic reticulum0.097

Rank 4 · TkA03G463810 · TK1151

Plastid0.053

Rank 5 · TkA03G463810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02519Auxin_inducible1-82 aa

PF02209VHP4-14 aa

PF02209VHP38-55 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G463810	`PF02519`	Auxin_inducible	1	82	1.7e-28	99.4
TkA03G463810	`PF02209`	VHP	4	14	0.26	12.0
TkA03G463810	`PF02209`	VHP	38	55	0.26	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0V7Z5`	Arabidopsis thaliana	sp\|Q0V7Z5\|SAU64_ARATH Auxin-responsive protein SAUR64	48.700%	Swiss-Prot	Medium
`Q9C7Q1`	Arabidopsis thaliana	sp\|Q9C7Q1\|SAU66_ARATH Auxin-responsive protein SAUR66	43.300%	Swiss-Prot	Medium
`F4I1H5`	Arabidopsis thaliana	sp\|F4I1H5\|SAU63_ARATH Auxin-responsive protein SAUR63	43.200%	Swiss-Prot	Medium
`F4I1I4`	Arabidopsis thaliana	sp\|F4I1I4\|SAU67_ARATH Auxin-responsive protein SAUR67	43.900%	Swiss-Prot	Medium
`Q0WPR6`	Arabidopsis thaliana	sp\|Q0WPR6\|SAU65_ARATH Auxin-responsive protein SAUR65	43.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card