LXL04_023861 | RubberDandelionOmics

Gene overview

LXL04_023861

Reference: OH-1004 Chr: Chr05 Coordinates: 71577666-71578046 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

381 bp · LXL04_023861|LXL04_023861|OH1004|cDNA

ATGTTGAGGCCTAAGAAGCTCCTGAGAATGGCAAGAAAATGGCGTAGAGAGGCGGCCAAGAGTGCTGCAAGGGTGGCCGACAAGGGTCATTTTGTTGTTTACACGGTGGATCATAGTCGTTTTGTGATTCCGTTGCATTATCTCAACAACAATATATTTCGTGAGCTTTTGAAGATGTCCGAGGATGAGTTTGGGCTGCCAACAAACAGGCCTATAACTTTGCCTTGTGACTCAAGCCTCATGAACTATTTAGTGAATGT...

CDS

Download CDS FASTA

381 bp · LXL04_023861|LXL04_023861|OH1004|CDS

ATGTTGAGGCCTAAGAAGCTCCTGAGAATGGCAAGAAAATGGCGTAGAGAGGCGGCCAAGAGTGCTGCAAGGGTGGCCGACAAGGGTCATTTTGTTGTTTACACGGTGGATCATAGTCGTTTTGTGATTCCGTTGCATTATCTCAACAACAATATATTTCGTGAGCTTTTGAAGATGTCCGAGGATGAGTTTGGGCTGCCAACAAACAGGCCTATAACTTTGCCTTGTGACTCAAGCCTCATGAACTATTTAGTGAATGT...

Protein

Download Protein FASTA

126 aa · LXL04_023861|LXL04_023861|OH1004|PROTEIN

MLRPKKLLRMARKWRREAAKSAARVADKGHFVVYTVDHSRFVIPLHYLNNNIFRELLKMSEDEFGLPTNRPITLPCDSSLMNYLVNVFERSPTKDLEALLISIATNRCSSFDQGGENRKQVLVYGF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023861`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023861

Location Chr05:71577666-71578046 (-)

Description Similar to SAUR64: Auxin-responsive protein SAUR64

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29450`	May promote auxin-stimulated organ elongation, such as hypocotyls, stamen filaments and petals.	No verified direct reference in this release
`At1g29500`	May promote auxin-stimulated organ elongation, such as hypocotyls, stamen filaments and petals.	No verified direct reference in this release
`At1g29460`	May promote auxin-stimulated organ elongation, such as hypocotyls, stamen filaments and petals.	No verified direct reference in this release
`At1g29420`	May promote auxin-stimulated organ elongation, such as hypocotyls, stamen filaments and petals.	No verified direct reference in this release
`At1g29430`	May promote auxin-stimulated organ elongation, such as hypocotyls, stamen filaments and petals.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023861 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009926 auxin polar transport Biological Process

GO:0042255 ribosome assembly Biological Process

GO:0080086 stamen filament development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0090406 pollen tube Cellular Component

KEGG gene cross-reference

ath:AT1G29420

ath:AT1G29430

ath:AT1G29450

ath:AT1G29460

ath:AT1G29500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.421

Rank 1 · LXL04_023861 · OH-1004

Nucleus0.298

Rank 2 · LXL04_023861 · OH-1004

Cell membrane0.270

Rank 3 · LXL04_023861 · OH-1004

Plastid0.084

Rank 4 · LXL04_023861 · OH-1004

Endoplasmic reticulum0.080

Rank 5 · LXL04_023861 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02519.21Auxin_inducible5-91 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023861	`PF02519.21`	Auxin_inducible	5	91	2.2e-30	105.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0V7Z5`	Arabidopsis thaliana	Auxin-responsive protein SAUR64	47.581%	Swiss-Prot	moderate database homology
`Q9C7Q1`	Arabidopsis thaliana	Auxin-responsive protein SAUR66	43.382%	Swiss-Prot	moderate database homology
`Q0WPR6`	Arabidopsis thaliana	Auxin-responsive protein SAUR65	43.919%	Swiss-Prot	moderate database homology
`Q6NMM0`	Arabidopsis thaliana	Auxin-responsive protein SAUR61	45.968%	Swiss-Prot	moderate database homology
`Q9C7Q8`	Arabidopsis thaliana	Auxin-responsive protein SAUR62	49.558%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card