Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2118 bp · TkA03G445220|TK1151|cDNA
TTTGATTTTTTTTTTGTTGAACAATCGTGGCTACCGTCGATCCTTGTGGCAGCACAGCAGCAAGTTTTCCGGTACCGCCCGGATCTGCACATAGCGAGTGTTTGCCGTTGCTAAGGCTTTTGTCCTCACCACTCAATTCCGGAGTCCAAGTTGTCCAACATCATATGCTGGAGATTTCAGTTATTAGAACACAAAGGTATGTGATTCACAAATCGATACAATATTGCGATCCAGTTTTCTACAAGTCTATCCAGCCATCC...
1599 bp · TkA03G445220|TK1151|CDS
ATGGAACCTAAATCCCCTTCAAAAGCAAAGCTTCCAATTTCGGGATTTTTTCATCACTCTAGAGTACTAAAATCAAGCATCGCCATTGTACTAGTTCTACTGTTGATCTCAACTGGTTATTACCTCATTCGTAATCCGATATTTCCCACACATAGTTCGTATTTCACTGTCGTGTTGGACTGCGGAAGCAGCGGAACAAGAGTAAACATATACGAGTGGAAATCCAACAAGAATCGAAATCAGAAATTGCCGATTTTACT...
Protein
Download Protein FASTA532 aa · TkA03G445220|TK1151|PROTEIN
MEPKSPSKAKLPISGFFHHSRVLKSSIAIVLVLLLISTGYYLIRNPIFPTHSSYFTVVLDCGSSGTRVNIYEWKSNKNRNQKLPILLHSFPNNSTKIHDRKDGCAYHCMQTEPGLDKFVGNASGVKASLEPLIRRAEKWVPYERHKTTPIFVLATAGLRRLNKDIANKVLDDVEAVVKLHKFNYRKDWIRVLSGREEAYYGWIALNYHMNIFGNSSRLSTLGLLDLGGSSLQVATEIKHPTINVDVFKSKIGLFEHQILA...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G445220 |
|---|---|
| TK1151 ID | TkA03G445220 |
| OH-1004 ID | LXL04_035102 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 37.200 |
| Protein coverage (%) | TK1151 84.023 / OH-1004 57.797Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G445220 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:111027029-111029220 (+) | |||||||||
| Description | Similar to APY7: Probable apyrase 7 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0009134 nucleoside diphosphate catabolic process Biological Process GO:0009901 anther dehiscence Biological Process GO:0010584 pollen exine formation Biological Process GO:0000325 plant-type vacuole Cellular Component GO:0005634 nucleus Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009507 chloroplast Cellular Component GO:0016020 membrane Cellular Component GO:0030659 cytoplasmic vesicle membrane Cellular Component GO:0004050 apyrase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0017110 nucleoside diphosphate phosphatase activity Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT1G14230 ath:AT1G14240 ath:AT1G14250 ath:AT2G02970 ath:AT4G19180 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF07125DUF137828-45 aaPF01150GDA1_CD3952-468 aaPF02541Ppx-GppA145-239 aaPF07125DUF1378488-501 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G445220 | PF07125 | DUF1378 | 28 | 45 | 0.22 | 12.4 |
| TkA03G445220 | PF01150 | GDA1_CD39 | 52 | 468 | 5.1e-57 | 194.2 |
| TkA03G445220 | PF02541 | Ppx-GppA | 145 | 239 | 0.073 | 13.2 |
| TkA03G445220 | PF07125 | DUF1378 | 488 | 501 | 0.22 | 12.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.