TkA03G443610 | RubberDandelionOmics

Gene overview

TkA03G443610

Reference: TK1151 Chr: Chr03 Coordinates: 110595841-110601005 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

643 bp · TkA03G443610|TK1151|cDNA

TTGACTTCCTCATTTCTCATCTAAACAAATCTTATTGGGGAAGACTACCACCTTATGGTGGACCATGGAGTAGGAGAATGTTGAACCTCCCCATATATATTTGTGTATGTTTATTTGGTGTTATAACATTGGCGTCGAAGGTTGTGATAAGGTGTACGCCAAACATGAAGGGAACTATGAGGTACTTGGCTGGGATTGCAGGTCAAAGTGGATATGGATCAAAGTCAACTGCTGATCAAGTTACTCAAGATTGTTCTTCC...

CDS

Download CDS FASTA

1080 bp · TkA03G443610|TK1151|CDS

ATGTTGAACCTCCCCATATATATTTGTGTATGTTTATTTGGTGTTATAACATTGGCGTCGAAGGTTGTGATAAGGTGTACGCCAAACATGAAGGGAACTATGAGGTACTTGGCTGGGATTGCAGGTCAAAGTGGATATGGATCAAAGTCAACTGCTGATCAAGTTACTCAAGATTGTTCTTCCATCCCTCCTCATCTCACTGCTATTGTCACCGGAGCAACGTCAGGAATTGGGGCAGAGACAGCTAGAGTGTTAGCAAA...

Protein

Download Protein FASTA

359 aa · TkA03G443610|TK1151|PROTEIN

MLNLPIYICVCLFGVITLASKVVIRCTPNMKGTMRYLAGIAGQSGYGSKSTADQVTQDCSSIPPHLTAIVTGATSGIGAETARVLAKRGVKIVMPARDLKKAARVKENILKEHPKANIIILEIDLSSFASIRKFCSEFLSLDIPLNILINNAGKFSQKLEFSEDKFEMTFATNYLGHFLLTELLLEKMIDTTRKTGVQGRIVNVSSVIHGWVKMEHFNFNRMLQPTNYNATRAYAQSKLANIMHAKELATQMKAINANIT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G443610`
TK1151 ID	TkA03G443610
OH-1004 ID	LXL04_009512
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G443610

Location Chr03:110595841-110601005 (+)

Description Similar to TIC32B: Short-chain dehydrogenase TIC 32 B, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g23430`	Involved in protein precursor import into chloroplasts.	Tic32, an essential component in chloroplast biogenesis.2004 · DOI: 10.1074/jbc.m402817200

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009512 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005765 lysosomal membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT4G23430

bna:106397857

hsa:57665

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.334

Rank 1 · TkA03G443610 · TK1151

Endoplasmic reticulum0.283

Rank 2 · TkA03G443610 · TK1151

Cytoplasm0.181

Rank 3 · TkA03G443610 · TK1151

Peroxisome0.117

Rank 4 · TkA03G443610 · TK1151

Cell membrane0.080

Rank 5 · TkA03G443610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106adh_short67-208 aa

PF08659KR67-190 aa

PF01370Epimerase69-261 aa

PF16363GDP_Man_Dehyd69-249 aa

PF05368NmrA69-133 aa

PF13561adh_short_C272-279 aa

PF13460NAD_binding_1072-210 aa

PF18536DUF5623181-218 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G443610	`PF00106`	adh_short	67	208	2.3e-34	119.3
TkA03G443610	`PF08659`	KR	67	190	3.1e-08	34.5
TkA03G443610	`PF01370`	Epimerase	69	261	1.3e-08	35.3
TkA03G443610	`PF16363`	GDP_Man_Dehyd	69	249	0.0021	18.3
TkA03G443610	`PF05368`	NmrA	69	133	0.15	12.3
TkA03G443610	`PF13561`	adh_short_C2	72	279	9.9e-19	68.6
TkA03G443610	`PF13460`	NAD_binding_10	72	210	0.17	12.5
TkA03G443610	`PF18536`	DUF5623	181	218	0.19	12.6
TkA03G443610	`PF01573`	Bromo_MP	198	290	0.0059	16.7
TkA03G443610	`PF00106`	adh_short	228	274	2.3e-34	119.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A2RVM0`	Arabidopsis thaliana	sp\|A2RVM0\|TIC32_ARATH Short-chain dehydrogenase TIC 32, chloroplastic	48.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card