TkA03G441420 | RubberDandelionOmics

Gene overview

TkA03G441420

Reference: TK1151 Chr: Chr03 Coordinates: 109998727-110002268 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1429 bp · TkA03G441420|TK1151|cDNA

CGTTCACCTCCCAACGCTTGATTGTTTGGTCAATATTAGGGTTGCGTTAGGGTTGGGTTTTCCATCGCATATCTACGCAATTACAGTATTATCTCTTCAAGATCGTCTCTCTGAAAACGTAGTCGGCTTTTCGATCGTCAATTAACGAGTTTATTTTTGGAATCGCAAACGATTATGGAGATGGAGCGTGTTACGGAGTTTCCAATGGGTCAACTGGACCTCAGGCCGAGGAAGCGACAGAGATTGGGGTGGGATGTGGT...

CDS

Download CDS FASTA

600 bp · TkA03G441420|TK1151|CDS

ATGTTTTACAACAACTTGGTAAACATGATAAAGGAGGAAGTCGTCATGCATGACTTGAGGCTGATTCACACTGATTTGAAGCCTGAAAACATTCTTCTTGTGTCTCCAGAGTATGTCAAAGTGCCTGATTACAAGGGTTCATCAAGGTCACCAAAGGATAGTTCTTTTTCGAAAAGAGTCCCGAAATCAAGTGCTATTAAGGTGATTGACTTTGGTAGTACAACATATGACAGACAGGACCAAAGTTACATAGTGTCCAC...

Protein

Download Protein FASTA

199 aa · TkA03G441420|TK1151|PROTEIN

MFYNNLVNMIKEEVVMHDLRLIHTDLKPENILLVSPEYVKVPDYKGSSRSPKDSSFSKRVPKSSAIKVIDFGSTTYDRQDQSYIVSTRHYRAPEVILGLGWSYPCDIWSVGCILVELCSGEALFQTHENLEHLAMMERVLGPLPTHMLKKADRHADKYVRKGRLDWPEGAASRESIKAVMKLPRLQNLIMQHVDHSAGI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G441420`
TK1151 ID	TkA03G441420
OH-1004 ID	LXL04_009481
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.200
Protein coverage (%)	TK1151 88.945 / OH-1004 16.004 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G441420

Location Chr03:109998727-110002268 (+)

Description Similar to QS: Quinolinate synthase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g24740`	Serine/threonine-protein kinase AFC2.	No verified direct reference in this release
`At3g53570`	Activator of yeast transcription factor, STE12.	No verified direct reference in this release
`At4g32660`	Serine/threonine-protein kinase AFC3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009481 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0009060 aerobic respiration Biological Process

GO:0009435 NAD+ biosynthetic process Biological Process

GO:0009820 alkaloid metabolic process Biological Process

GO:0016226 iron-sulfur cluster assembly Biological Process

GO:0034628 'de novo' NAD+ biosynthetic process from L-aspartate Biological Process

GO:0042179 nicotine biosynthetic process Biological Process

GO:0043484 regulation of RNA splicing Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT4G24740

ath:AT5G50210

nta:107813484

nta:107817199

osa:107275865

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.706

Rank 1 · TkA03G441420 · TK1151

Cytoplasm0.371

Rank 2 · TkA03G441420 · TK1151

Mitochondrion0.038

Rank 3 · TkA03G441420 · TK1151

Cell membrane0.032

Rank 4 · TkA03G441420 · TK1151

Endoplasmic reticulum0.022

Rank 5 · TkA03G441420 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase16-135 aa

PF07714PK_Tyr_Ser-Thr17-137 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G441420	`PF00069`	Pkinase	16	135	4.2e-24	86.1
TkA03G441420	`PF07714`	PK_Tyr_Ser-Thr	17	137	8e-09	35.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P51567`	Arabidopsis thaliana	sp\|P51567\|AFC2_ARATH Serine/threonine-protein kinase AFC2	83.600%	Swiss-Prot	High
`P51566`	Arabidopsis thaliana	sp\|P51566\|AFC1_ARATH Serine/threonine-protein kinase AFC1	76.400%	Swiss-Prot	High
`P51568`	Arabidopsis thaliana	sp\|P51568\|AFC3_ARATH Serine/threonine-protein kinase AFC3	64.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card