LXL04_009481 | RubberDandelionOmics

Gene overview

LXL04_009481

Reference: OH-1004 Chr: Chr02 Coordinates: 127174675-127184771 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3321 bp · LXL04_009481|LXL04_009481|OH1004|cDNA

ATGGAGATGGAGCGTGTTACGGAGTTTCCAATGGGTCAACTGGACCTCAGGCCGAGGAAGCGACAGAGATTGGGGTGGGATGTGGTTCCTACACCACCGAAGGCTCAGCTAGGATTGTTTTGTGGGCAAGAGATTGGAAATGTTGCCAGCTTTGCATCTCCACGAGCACCATCAGACCACATTAGTTCTCCCCTTGTTAAGCGCGTGGCTCGAAATGCTTCTCCCCCATGGCGCCAAGATGATAAAGATGGACATTATGT...

CDS

Download CDS FASTA

3321 bp · LXL04_009481|LXL04_009481|OH1004|CDS

ATGGAGATGGAGCGTGTTACGGAGTTTCCAATGGGTCAACTGGACCTCAGGCCGAGGAAGCGACAGAGATTGGGGTGGGATGTGGTTCCTACACCACCGAAGGCTCAGCTAGGATTGTTTTGTGGGCAAGAGATTGGAAATGTTGCCAGCTTTGCATCTCCACGAGCACCATCAGACCACATTAGTTCTCCCCTTGTTAAGCGCGTGGCTCGAAATGCTTCTCCCCCATGGCGCCAAGATGATAAAGATGGACATTATGT...

Protein

Download Protein FASTA

1106 aa · LXL04_009481|LXL04_009481|OH1004|PROTEIN

MEMERVTEFPMGQLDLRPRKRQRLGWDVVPTPPKAQLGLFCGQEIGNVASFASPRAPSDHISSPLVKRVARNASPPWRQDDKDGHYVFAIGDNLTSRYKIHGKMGEGTFGQVLECWDKERKEMVAIKIVRGIKKYREAAMIEIDVLQQLVMHDLRLIHTDLKPENILLVSPEYVKVPDYKGSSRSPKDSSFSKRVPKSSAIKVIDFGSTTYDRQDQSYIVSTRHYRAPEVILGLGWSYPCDIWSVGCILVELCSGEALFQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009481`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009481

Location Chr02:127174675-127184771 (+)

Description Similar to QS: Quinolinate synthase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g50210`	Catalyzes the condensation of iminoaspartate with dihydroxyacetone phosphate to form quinolinate.	Characterization of Arabidopsis thaliana SufE2 and SufE3: functions in chloroplast iron-sulfur cluster assembly and Nad synthesis.2007 · DOI: 10.1074/jbc.m701428200 The Arabidopsis onset of leaf death5 mutation of quinolinate synthase affects nicotinamide adenine dinucleotide biosynthesis and causes early ageing.2008 · DOI: 10.1105/tpc.107.056341
`At4g24740`	Serine/threonine-protein kinase AFC2.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0290150`	Catalyzes the condensation of iminoaspartate with dihydroxyacetone phosphate to form quinolinate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009481 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0009060 aerobic respiration Biological Process

GO:0009435 NAD+ biosynthetic process Biological Process

GO:0009820 alkaloid metabolic process Biological Process

GO:0016226 iron-sulfur cluster assembly Biological Process

GO:0034628 'de novo' NAD+ biosynthetic process from L-aspartate Biological Process

GO:0042179 nicotine biosynthetic process Biological Process

GO:0043484 regulation of RNA splicing Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT4G24740

ath:AT5G50210

nta:107813484

nta:107817199

osa:107275865

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.767

Rank 1 · LXL04_009481 · OH-1004

Cytoplasm0.162

Rank 2 · LXL04_009481 · OH-1004

Nucleus0.132

Rank 3 · LXL04_009481 · OH-1004

Mitochondrion0.068

Rank 4 · LXL04_009481 · OH-1004

Peroxisome0.052

Rank 5 · LXL04_009481 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase98-149 aa

PF00069.32Pkinase151-269 aa

PF07714.24PK_Tyr_Ser-Thr152-272 aa

PF02657.22SufE454-580 aa

PF02445.22NadA630-940 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009481	`PF00069.32`	Pkinase	98	149	1e-29	104.5
LXL04_009481	`PF00069.32`	Pkinase	151	269	1e-29	104.5
LXL04_009481	`PF07714.24`	PK_Tyr_Ser-Thr	152	272	2.4e-11	44.1
LXL04_009481	`PF02657.22`	SufE	454	580	4.1e-30	104.9
LXL04_009481	`PF02445.22`	NadA	630	940	7.7e-31	108.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGS4`	Arabidopsis thaliana	Quinolinate synthase, chloroplastic	73.948%	Swiss-Prot	moderate database homology
`P51567`	Arabidopsis thaliana	Serine/threonine-protein kinase AFC2	62.078%	Swiss-Prot	weak database homology
`Q2QTL0`	Oryza sativa subsp. japonica	Quinolinate synthase, chloroplastic	62.500%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card