TkA03G428520 | RubberDandelionOmics

Gene overview

TkA03G428520

Reference: TK1151 Chr: Chr03 Coordinates: 106608221-106611110 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1210 bp · TkA03G428520|TK1151|cDNA

GATTATTCTCGTTATAAGTCACCCGACAATCTCCATCTTCCTCCCTCCTTCAAAAATTCAATACACTTTGGCTTAACCATGGATCTGATCCACAAGCTCTTAAACTTTGTTCTTCCTATCGTAACCATCGTCCTCTTAGTATTGCTCTATCCCCTGGTCTTACTGTTCAGGTTCTTCAACTACCTTATCAGATTCGCTTTCCCTGAAAAACTCGCCCGAAAGGTAGCACTCATCACCGGAGCTTCTTCTGGTATCGGAGA...

CDS

Download CDS FASTA

915 bp · TkA03G428520|TK1151|CDS

ATGGATCTGATCCACAAGCTCTTAAACTTTGTTCTTCCTATCGTAACCATCGTCCTCTTAGTATTGCTCTATCCCCTGGTCTTACTGTTCAGGTTCTTCAACTACCTTATCAGATTCGCTTTCCCTGAAAAACTCGCCCGAAAGGTAGCACTCATCACCGGAGCTTCTTCTGGTATCGGAGAGTATTTGGCGTATGAATATGCAAAAAGTGGAGCGAGATTAGCGTTGGTTGCGAGAAGAAAGGAACAGCTGGAGGCGGT...

Protein

Download Protein FASTA

304 aa · TkA03G428520|TK1151|PROTEIN

MDLIHKLLNFVLPIVTIVLLVLLYPLVLLFRFFNYLIRFAFPEKLARKVALITGASSGIGEYLAYEYAKSGARLALVARRKEQLEAVAGRARELGSPDVIVISADVSKVDDCKRFVDETIHHFGTLNHLVNNAGVCYIEDQRSSSDYLSLMDINFWGSVNTTQFALPHLHNSKGKIVVVSSCAGWFAMPKLGIYCASKAALIRYFETLRVEVGSDIGITIVTPGVVESSITNEEWLLKTNLDWAPMMSTEGCAKGILNGT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G428520`
TK1151 ID	TkA03G428520
OH-1004 ID	LXL04_009355
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 90.476 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G428520

Location Chr03:106608221-106611110 (-)

Description Similar to HSD2: 11-beta-hydroxysteroid dehydrogenase-like 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g47350`	11-beta-hydroxysteroid dehydrogenase-like 2.	No verified direct reference in this release
`At5g50590`	11-beta-hydroxysteroid dehydrogenase-like 4A.	No verified direct reference in this release
`At5g50690`	11-beta-hydroxysteroid dehydrogenase-like 4B.	No verified direct reference in this release
`At3g47360`	11-beta-hydroxysteroid dehydrogenase-like 3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009355 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006694 steroid biosynthetic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0016491 oxidoreductase activity Molecular Function

GO:0070524 11-beta-hydroxysteroid dehydrogenase (NADP+) activity Molecular Function

KEGG gene cross-reference

ath:AT3G47350

ath:AT3G47360

ath:AT5G50590

ath:AT5G50600

ath:AT5G50690

ath:AT5G50700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.726

Rank 1 · TkA03G428520 · TK1151

Cytoplasm0.132

Rank 2 · TkA03G428520 · TK1151

Cell membrane0.091

Rank 3 · TkA03G428520 · TK1151

Golgi apparatus0.081

Rank 4 · TkA03G428520 · TK1151

Mitochondrion0.076

Rank 5 · TkA03G428520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106adh_short48-233 aa

PF08659KR50-200 aa

PF01370Epimerase50-182 aa

PF13561adh_short_C254-232 aa

PF13460NAD_binding_1054-116 aa

PF13460NAD_binding_10187-227 aa

PF00106adh_short273-287 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G428520	`PF00106`	adh_short	48	233	1.1e-45	156.2
TkA03G428520	`PF08659`	KR	50	200	5.7e-10	40.1
TkA03G428520	`PF01370`	Epimerase	50	182	0.00044	20.4
TkA03G428520	`PF13561`	adh_short_C2	54	232	1.3e-29	104.2
TkA03G428520	`PF13460`	NAD_binding_10	54	116	0.057	14.0
TkA03G428520	`PF13460`	NAD_binding_10	187	227	0.057	14.0
TkA03G428520	`PF00106`	adh_short	273	287	1.1e-45	156.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9STY8`	Arabidopsis thaliana	sp\|Q9STY8\|HSD2_ARATH 11-beta-hydroxysteroid dehydrogenase-like 2	50.500%	Swiss-Prot	High
`P0DKC7`	Arabidopsis thaliana	sp\|P0DKC7\|HSD4A_ARATH 11-beta-hydroxysteroid dehydrogenase-like 4A	49.300%	Swiss-Prot	Medium
`Q9LUF2`	Arabidopsis thaliana	sp\|Q9LUF2\|HSD4B_ARATH 11-beta-hydroxysteroid dehydrogenase-like 4B	49.300%	Swiss-Prot	Medium
`Q9STY7`	Arabidopsis thaliana	sp\|Q9STY7\|HSD3_ARATH 11-beta-hydroxysteroid dehydrogenase-like 3	50.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card