TkA03G405160 | RubberDandelionOmics

Gene overview

TkA03G405160

Reference: TK1151 Chr: Chr03 Coordinates: 100749365-100751834 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1111 bp · TkA03G405160|TK1151|cDNA

TTGTGATTTGGAATGTTGGATGACAAAACTGTTGTCTGATATTGATGTGTCAAGAACTGTTCATGTGGCAATCTTTTTGGATTTAGAATCGGCTGCAAGGGAAGGTATGTCTCTATTTTCTTATTTTTTAACAATAAAAATAATAAGTATAATTATATTAAACTGTTCTATTGGTATTTCAGCATGCTGTGAGTTGAATCAGAATGATTCCATTTCCATTTCCACTGACATTGACACATCTGATGTTAGTGCTTCAAGTC...

CDS

Download CDS FASTA

1374 bp · TkA03G405160|TK1151|CDS

ATGAGTATGTACGGATACGATGTATCTTTCCACGATTACGGTTTCTCCGATACGGTAATCGCAGGTTCAATCTATGGAAATTCGCTTTCTTCGATGGCAGCCGCAGTTGAATATGATGACGAGCTTTATGCCAGACGAAGGCCGCCGCCGTCGAGGCCGAGTCCTCCAATCATAACCCCTGGCAGCCCGCCGAGGTACCGCCATGACGGCACTTCTCCTCTTCCTCTAGGCATGGACTGGAGTCTCGCCCCTCTTATTTG...

Protein

Download Protein FASTA

457 aa · TkA03G405160|TK1151|PROTEIN

MSMYGYDVSFHDYGFSDTVIAGSIYGNSLSSMAAAVEYDDELYARRRPPPSRPSPPIITPGSPPRYRHDGTSPLPLGMDWSLAPLIWEGRNSVWPHDLHKGWSYCVTIPSLSSEQSAGSSDAVFYSVKVGIQSPEGITTTRTVPRRFNEFLKLYSELKKEFPKKNLPPAPPKRFVKPRSKKVLVDRICDLECWMTKLLSDIDVSRTVHVAIFLDLESAAREACCELNQNDSISISTDIDTSDVSASSPEKETCDELNSHV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G405160`
TK1151 ID	TkA03G405160
OH-1004 ID	LXL04_009172
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.500
Protein coverage (%)	TK1151 100.000 / OH-1004 79.478 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G405160

Location Chr03:100749365-100751834 (-)

Description Similar to EREL1: PX domain-containing protein EREL1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32160`	Acts as an effector of RABF2A and RABF2B (By similarity).	No verified direct reference in this release
`At2g25350`	Acts as an effector of RABF2A and RABF2B (By similarity).	No verified direct reference in this release
`At3g15920`	Acts as an effector of RABF2A and RABF2B.	ENDOSOMAL RAB EFFECTOR WITH PX-DOMAIN, an Interacting Partner of RAB5 GTPases, Regulates Membrane Trafficking to Protein Storage Vacuoles in Arabidopsis.2016 · DOI: 10.1105/tpc.16.00326

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009172 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0010008 endosome membrane Cellular Component

GO:0035091 phosphatidylinositol binding Molecular Function

KEGG gene cross-reference

ath:AT2G25350

ath:AT4G32160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.411

Rank 1 · TkA03G405160 · TK1151

Nucleus0.296

Rank 2 · TkA03G405160 · TK1151

Cell membrane0.289

Rank 3 · TkA03G405160 · TK1151

Golgi apparatus0.091

Rank 4 · TkA03G405160 · TK1151

Lysosome / Vacuole0.072

Rank 5 · TkA03G405160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00787PX139-214 aa

PF14916CCDC92250-270 aa

PF27806HxsD260-260 aa

PF14916CCDC92303-319 aa

PF27806HxsD303-347 aa

PF14916CCDC92323-349 aa

PF27806HxsD422-445 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G405160	`PF00787`	PX	139	214	2.4e-13	51.1
TkA03G405160	`PF14916`	CCDC92	250	270	1.5	9.4
TkA03G405160	`PF27806`	HxsD	260	260	5.0	7.9
TkA03G405160	`PF14916`	CCDC92	303	319	1.5	9.4
TkA03G405160	`PF27806`	HxsD	303	347	5.0	7.9
TkA03G405160	`PF14916`	CCDC92	323	349	1.5	9.4
TkA03G405160	`PF27806`	HxsD	422	445	5.0	7.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JTJ2`	Arabidopsis thaliana	sp\|F4JTJ2\|EREL1_ARATH PX domain-containing protein EREL1	60.400%	Swiss-Prot	Low
`Q8S8D3`	Arabidopsis thaliana	sp\|Q8S8D3\|EREL2_ARATH PX domain-containing protein EREL2	56.800%	Swiss-Prot	Low
`Q9LSB9`	Arabidopsis thaliana	sp\|Q9LSB9\|EREX_ARATH PX domain-containing protein EREX	47.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card