TkA03G404580 | RubberDandelionOmics

Gene overview

TkA03G404580

Reference: TK1151 Chr: Chr03 Coordinates: 100588784-100590092 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1148 bp · TkA03G404580|TK1151|cDNA

CAACAATGATGGGAGTCAAGAACGAGAACATGCACACCACCGTGGAGCCGCAGCGTTTAAGGGACAAAAAGGTAAAGGAGCTTGTTTCCGACAAACGGAGGCTGGTGGAGGTTCCGTACACAGCTACCCTAGCTCACACCATGAACACGCTGGTGGCTAACCAGGTAGTGGCGGTGCCGGTGGCTGCACCACCTGGACATTGGATCGGAGCCGGTGGATCCATGATATTAGAGTCCGATAAACATACAGGTGCCGTCAGG...

CDS

Download CDS FASTA

1101 bp · TkA03G404580|TK1151|CDS

ATGATGGGAGTCAAGAACGAGAACATGCACACCACCGTGGAGCCGCAGCGTTTAAGGGACAAAAAGGTAAAGGAGCTTGTTTCCGACAAACGGAGGCTGGTGGAGGTTCCGTACACAGCTACCCTAGCTCACACCATGAACACGCTGGTGGCTAACCAGGTAGTGGCGGTGCCGGTGGCTGCACCACCTGGACATTGGATCGGAGCCGGTGGATCCATGATATTAGAGTCCGATAAACATACAGGTGCCGTCAGGAAACA...

Protein

Download Protein FASTA

366 aa · TkA03G404580|TK1151|PROTEIN

MMGVKNENMHTTVEPQRLRDKKVKELVSDKRRLVEVPYTATLAHTMNTLVANQVVAVPVAAPPGHWIGAGGSMILESDKHTGAVRKHYIGMVTMLDILAHMAGDNGGELSNMEERMAVPVSSIIGHCLESLSLWTLNPSTSILDCMEVFSKGIHRALVPLDSTMENVAGVELVESASTYKMLTQMDLMRFLKGHESDLKHVLDRTLKDLGAIVEPIFGVTDHTRVIDAIKSMRAGSLNAVPIVESSNPATEDHSKLVNGK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G404580`
TK1151 ID	TkA03G404580
OH-1004 ID	LXL04_009163
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 98.919 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G404580

Location Chr03:100588784-100590092 (-)

Description Similar to PV42A: SNF1-related protein kinase regulatory subunit gamma-like PV42a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g15330`	Plays redundant role with PV42b in regulating male gametogenesis and pollen tube guidance.	AtPV42a and AtPV42b redundantly regulate reproductive development in Arabidopsis thaliana.2011 · DOI: 10.1371/journal.pone.0019033
`At1g80090`	Plays redundant role with PV42a in regulating male gametogenesis and pollen tube guidance.	AtPV42a and AtPV42b redundantly regulate reproductive development in Arabidopsis thaliana.2011 · DOI: 10.1371/journal.pone.0019033

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009163 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0003006 developmental process involved in reproduction Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009553 embryo sac development Biological Process

GO:0009555 pollen development Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0030071 regulation of mitotic metaphase/anaphase transition Biological Process

GO:0042149 cellular response to glucose starvation Biological Process

GO:0048443 stamen development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0031588 nucleotide-activated protein kinase complex Cellular Component

KEGG gene cross-reference

ath:AT1G15330

ath:AT1G80090

kla:KLLA0_F10769g

pno:SNOG_14603

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.481

Rank 1 · TkA03G404580 · TK1151

Nucleus0.400

Rank 2 · TkA03G404580 · TK1151

Lysosome / Vacuole0.131

Rank 3 · TkA03G404580 · TK1151

Cell membrane0.106

Rank 4 · TkA03G404580 · TK1151

Golgi apparatus0.087

Rank 5 · TkA03G404580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00571CBS30-59 aa

PF00571CBS87-102 aa

PF00571CBS134-163 aa

PF00571CBS181-192 aa

PF00571CBS213-247 aa

PF00571CBS310-358 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G404580	`PF00571`	CBS	30	59	4.4e-16	59.7
TkA03G404580	`PF00571`	CBS	87	102	4.4e-16	59.7
TkA03G404580	`PF00571`	CBS	134	163	4.4e-16	59.7
TkA03G404580	`PF00571`	CBS	181	192	4.4e-16	59.7
TkA03G404580	`PF00571`	CBS	213	247	4.4e-16	59.7
TkA03G404580	`PF00571`	CBS	310	358	4.4e-16	59.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XI37`	Arabidopsis thaliana	sp\|Q9XI37\|PV42A_ARATH SNF1-related protein kinase regulatory subunit gamma-like PV42a	60.800%	Swiss-Prot	High
`Q8GXI9`	Arabidopsis thaliana	sp\|Q8GXI9\|PV42B_ARATH SNF1-related protein kinase regulatory subunit gamma-like PV42b	58.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card