LXL04_009163 | RubberDandelionOmics

Gene overview

LXL04_009163

Reference: OH-1004 Chr: Chr02 Coordinates: 119409540-119410813 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1113 bp · LXL04_009163|LXL04_009163|OH1004|cDNA

ATGCAGACAACAATGATGGGAGCCAAGAACGAGAACATGCACACCACCGTGGAGCCGCAGCGTTTAAGGGACAAAAAGGTAAAGGAGCTTGTTTCCGACAAACGGAGGCTGGTGGAGGTTCCGTACACAGCTACCCTAGCTCACACCATGAACACGCTGGTGGCTAACCAGGTAGTGGCGGTGCCGGTGGCTGCACCACCTGGACATTGGATCGGAGCCGGTGGATCCATGATATTAGAGTCCGATAAACATACAGGTGC...

CDS

Download CDS FASTA

1113 bp · LXL04_009163|LXL04_009163|OH1004|CDS

ATGCAGACAACAATGATGGGAGCCAAGAACGAGAACATGCACACCACCGTGGAGCCGCAGCGTTTAAGGGACAAAAAGGTAAAGGAGCTTGTTTCCGACAAACGGAGGCTGGTGGAGGTTCCGTACACAGCTACCCTAGCTCACACCATGAACACGCTGGTGGCTAACCAGGTAGTGGCGGTGCCGGTGGCTGCACCACCTGGACATTGGATCGGAGCCGGTGGATCCATGATATTAGAGTCCGATAAACATACAGGTGC...

Protein

Download Protein FASTA

370 aa · LXL04_009163|LXL04_009163|OH1004|PROTEIN

MQTTMMGAKNENMHTTVEPQRLRDKKVKELVSDKRRLVEVPYTATLAHTMNTLVANQVVAVPVAAPPGHWIGAGGSMILESDKHTGAVRKHYIGMVTMLDILAHMAGDNGGELSNMEERMAVPVSSIIGHCLESLSLWTLNPSTSILDCMEVFSKGIHRALVPLDSTMENVAGVELVESASTYKMLTQMDLMRFLKGHESDLKHVLDRTLKDLGAIVEPIFGVTDHTRVIDAIKSMRAGSLNAVPIVESSNPATEDHSKL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009163`
TK1151 ID	TkA03G404580
OH-1004 ID	LXL04_009163
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 98.919 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009163

Location Chr02:119409540-119410813 (-)

Description Similar to PV42A: SNF1-related protein kinase regulatory subunit gamma-like PV42a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g15330`	Plays redundant role with PV42b in regulating male gametogenesis and pollen tube guidance.	AtPV42a and AtPV42b redundantly regulate reproductive development in Arabidopsis thaliana.2011 · DOI: 10.1371/journal.pone.0019033
`At1g80090`	Plays redundant role with PV42a in regulating male gametogenesis and pollen tube guidance.	AtPV42a and AtPV42b redundantly regulate reproductive development in Arabidopsis thaliana.2011 · DOI: 10.1371/journal.pone.0019033

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009163 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0003006 developmental process involved in reproduction Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009553 embryo sac development Biological Process

GO:0009555 pollen development Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0030071 regulation of mitotic metaphase/anaphase transition Biological Process

GO:0042149 cellular response to glucose starvation Biological Process

GO:0048443 stamen development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0031588 nucleotide-activated protein kinase complex Cellular Component

KEGG gene cross-reference

ath:AT1G15330

ath:AT1G80090

kla:KLLA0_F10769g

pno:SNOG_14603

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.483

Rank 1 · LXL04_009163 · OH-1004

Nucleus0.398

Rank 2 · LXL04_009163 · OH-1004

Lysosome / Vacuole0.129

Rank 3 · LXL04_009163 · OH-1004

Cell membrane0.109

Rank 4 · LXL04_009163 · OH-1004

Golgi apparatus0.085

Rank 5 · LXL04_009163 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00571.34CBS314-362 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009163	`PF00571.34`	CBS	314	362	3.8e-16	59.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XI37`	Arabidopsis thaliana	SNF1-related protein kinase regulatory subunit gamma-like PV42a	60.172%	Swiss-Prot	strong database homology
`Q8GXI9`	Arabidopsis thaliana	SNF1-related protein kinase regulatory subunit gamma-like PV42b	58.405%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card