Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1622 bp · TkA03G400340|TK1151|cDNA
TAGTAAGCGAGCATTGCTTTAGAAAATCACATCATCGCTGACGAGAGTTTCTTGCGGGAAAAGATAATTGGGGTTCTATTTATCATACTAATTCCAATCCAATACGTAGAGATTGTCGACGAATTTGGTTACCGGCGGAGCTCCGTCAATTGTGTTTCCATCATCTGGTTCGAATTGTTTAGTTTCTTACAGCAATAGGTGAAGGAGTTCTCCACCATGGATCTCAATGATCTCAACAAAGTCTGGGAAGTGAAACCTCT...
933 bp · TkA03G400340|TK1151|CDS
ATGGATCTCAATGATCTCAACAAAGTCTGGGAAGTGAAACCTCTAAAAAAGCCCCGTGAAGATGAGGCAAAAGAAATCCTCGAAAAAGTAGCAAAGCAAGTTCAACCCATCATGCGAAAGCACAATTGGAAAGTCAACATCCTCTCTGAATTCTGCCCTCCAAATCCCGCTCTTCTTGGCCTAAACATAAACGGAGGGGCAGAAGTAAAACTCAGACTTCGTAGACAAAACAACGAATGGGACTTCTTCCCATTTGAACA...
Protein
Download Protein FASTA310 aa · TkA03G400340|TK1151|PROTEIN
MDLNDLNKVWEVKPLKKPREDEAKEILEKVAKQVQPIMRKHNWKVNILSEFCPPNPALLGLNINGGAEVKLRLRRQNNEWDFFPFEQILDTMLHELCHNQYGPHNADFYNLLDEIRKECEELMAKGITGTGRGFDLPGRRLGGYNRPQTSSSLRQKALSAAQNRAQMGIVMPAGPHRLGGDSSLRTALSPIQAAAMAAERRLHDDLWCASKSSQSLELSGTSEPSVSISSSEESLSLWECDTCTLLNQTLVLTCEACGNP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G400340 |
|---|---|
| TK1151 ID | TkA03G400340 |
| OH-1004 ID | LXL04_009121 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 99.400 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 92.537Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G400340 |
|---|---|
| Location | Chr03:99545742-99547990 (-) |
| Description | Similar to WSS1: DNA-dependent metalloprotease WSS1 (Saccharomyces cerevisiae (strain ATCC 204508 / S288c) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006281 DNA repair Biological Process GO:0006508 proteolysis Biological Process GO:0016925 protein sumoylation Biological Process GO:0019985 translesion synthesis Biological Process GO:0036205 histone catabolic process Biological Process GO:0106300 protein-DNA covalent cross-linking repair Biological Process GO:1990414 replication-born double-strand break repair via sister chromatid exchange Biological Process GO:0005634 nucleus Cellular Component GO:0005635 nuclear envelope Cellular Component GO:0005829 cytosol Cellular Component GO:0003690 double-stranded DNA binding Molecular Function GO:0003697 single-stranded DNA binding Molecular Function |
| KEGG gene cross-reference | sce:YHR134W spo:2538751 spo:2543468 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF08325WLM8-202 aaPF01863YgjP-like13-41 aaPF01863YgjP-like92-121 aaPF15811SVIP148-166 aaPF15811SVIP186-203 aaPF03408Foamy_virus_ENV225-294 aaPF00641Zn_ribbon_RanBP238-262 aaPF28755DUF8455239-258 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G400340 | PF08325 | WLM | 8 | 202 | 1.3e-61 | 208.7 |
| TkA03G400340 | PF01863 | YgjP-like | 13 | 41 | 0.002 | 18.9 |
| TkA03G400340 | PF01863 | YgjP-like | 92 | 121 | 0.002 | 18.9 |
| TkA03G400340 | PF15811 | SVIP | 148 | 166 | 0.012 | 16.4 |
| TkA03G400340 | PF15811 | SVIP | 186 | 203 | 0.012 | 16.4 |
| TkA03G400340 | PF03408 | Foamy_virus_ENV | 225 | 294 | 0.035 | 12.6 |
| TkA03G400340 | PF00641 | Zn_ribbon_RanBP | 238 | 262 | 9.5e-09 | 35.1 |
| TkA03G400340 | PF28755 | DUF8455 | 239 | 258 | 5.1 | 7.8 |
| TkA03G400340 | PF12773 | DZR | 240 | 291 | 1.5 | 9.7 |
| TkA03G400340 | PF00641 | Zn_ribbon_RanBP | 271 | 291 | 9.5e-09 | 35.1 |
| TkA03G400340 | PF28755 | DUF8455 | 282 | 297 | 5.1 | 7.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.