TkA03G398840 | RubberDandelionOmics

Gene overview

TkA03G398840

Reference: TK1151 Chr: Chr03 Coordinates: 99123683-99126385 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2560 bp · TkA03G398840|TK1151|cDNA

ATAAAACAAACAAAATGCTATATTGCACATGGCCTCCGTAGTAATTTGCCAATTTGCTCTAATACCTTATCATTATCAATTAACCAGTTTTCCATCAAATTCAGCTTCTACAAAATTGTTCAACCAAAATGATAATTTAACCCCAATTATTTTTAAAATATTTTTAAATTCTCCCGTAATTCGCAAACGGAAAACCCAAGAATCGAAGGCGGTCGCCGAGCGCAGCTTGCCTTGGCTACCGGCCGTGTACATGGAATAAA...

CDS

Download CDS FASTA

1677 bp · TkA03G398840|TK1151|CDS

ATGGATAGAGAATCTTCCGACGACGAAGAAGATCGCCGCCATTTAATTCATCAAAACGACACAATCCCTAAATCCCCACGCCCTTCCACATTTCAGATCGATGAAGACGATCACCGCCAGTTCAAGAGCCCCCGTCATGCCTCCCAAGCTAACAATGTTCGCAATTTAATCTTCAATAAAAGGTACCTCTTCGCTATCGCTCTCCCCCTCCTCATCATCTTCATTTATTTCACTGCCGATTTCAAATCCCTATTCCGGAC...

Protein

Download Protein FASTA

558 aa · TkA03G398840|TK1151|PROTEIN

MDRESSDDEEDRRHLIHQNDTIPKSPRPSTFQIDEDDHRQFKSPRHASQANNVRNLIFNKRYLFAIALPLLIIFIYFTADFKSLFRTHLSSGSIQNDAVASNMMRESELRALQLLKQQESGLIDLWNRTSMPNLNSTSTSPNSIHDLRSALIDQISLNKKIQQALLSSHQFGNSFDFNEQNVTDPTMAACRKVDQKLSQRRTIEWKPKHDKYLFAICTSGQMSNHLICLEKHMFFAAILNRVLVIPSSKIDYEFSRVLDI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G398840`
TK1151 ID	TkA03G398840
OH-1004 ID	LXL04_009113
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G398840

Location Chr03:99123683-99126385 (+)

Description Similar to OFUT5: O-fucosyltransferase 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g50420`	O-fucosyltransferase 36.	No verified direct reference in this release
`At1g17270`	O-fucosyltransferase 5.	No verified direct reference in this release
`At1g53770`	O-fucosyltransferase 14.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009113 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006004 fucose metabolic process Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0016020 membrane Cellular Component

GO:0046922 peptide-O-fucosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G17270

ath:AT1G53770

ath:AT5G50420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.803

Rank 1 · TkA03G398840 · TK1151

Endoplasmic reticulum0.102

Rank 2 · TkA03G398840 · TK1151

Cytoplasm0.078

Rank 3 · TkA03G398840 · TK1151

Cell membrane0.055

Rank 4 · TkA03G398840 · TK1151

Extracellular0.039

Rank 5 · TkA03G398840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28573OFUT_helical_N101-167 aa

PF13344Hydrolase_6175-201 aa

PF10250O-FucT232-533 aa

PF13344Hydrolase_6305-325 aa

PF13344Hydrolase_6360-397 aa

PF13344Hydrolase_6427-467 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G398840	`PF28573`	OFUT_helical_N	101	167	2.5e-25	89.3
TkA03G398840	`PF13344`	Hydrolase_6	175	201	0.29	11.9
TkA03G398840	`PF10250`	O-FucT	232	533	1.9e-09	38.3
TkA03G398840	`PF13344`	Hydrolase_6	305	325	0.29	11.9
TkA03G398840	`PF13344`	Hydrolase_6	360	397	0.29	11.9
TkA03G398840	`PF13344`	Hydrolase_6	427	467	0.29	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FK30`	Arabidopsis thaliana	sp\|Q9FK30\|OFT36_ARATH O-fucosyltransferase 36	59.000%	Swiss-Prot	High
`Q84WU0`	Arabidopsis thaliana	sp\|Q84WU0\|OFUT5_ARATH O-fucosyltransferase 5	58.800%	Swiss-Prot	High
`Q501D6`	Arabidopsis thaliana	sp\|Q501D6\|OFT14_ARATH O-fucosyltransferase 14	62.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card