TkA03G395140 | RubberDandelionOmics

Gene overview

TkA03G395140

Reference: TK1151 Chr: Chr03 Coordinates: 98148910-98149790 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

597 bp · TkA03G395140|TK1151|cDNA

CATATCCTTCATTTTTCCAGTTCCCATGGCTTCCCTTCTTTCAACTTCAGCCGCTCCTTCATCCACCTTTCTTCTTCCCACAACTCCCAGAATTCAATCCACCCAACTCTCCAGCGTCTCCATGATCTCTGGTGGACAAAGATTTGTAATCTTGAAGGCGGAGAAAAGATCATCACCACTTTCTCACTGCTTCAAAACCACGATTTCATGCTCCATTGCTCAACCAGAGACACTGAAAATAGTGCAAGCCACCATTGCTA...

CDS

Download CDS FASTA

435 bp · TkA03G395140|TK1151|CDS

ATGGCTTCCCTTCTTTCAACTTCAGCCGCTCCTTCATCCACCTTTCTTCTTCCCACAACTCCCAGAATTCAATCCACCCAACTCTCCAGCGTCTCCATGATCTCTGGTGGACAAAGATTTGTAATCTTGAAGGCGGAGAAAAGATCATCACCACTTTCTCACTGCTTCAAAACCACGATTTCATGCTCCATTGCTCAACCAGAGACACTGAAAATAGTGCAAGCCACCATTGCTAATCAGTTGTCGATTGATGAGAGCAC...

Protein

Download Protein FASTA

144 aa · TkA03G395140|TK1151|PROTEIN

MASLLSTSAAPSSTFLLPTTPRIQSTQLSSVSMISGGQRFVILKAEKRSSPLSHCFKTTISCSIAQPETLKIVQATIANQLSIDESTVAPATKFADLGADSLDTVEIMMALEEKFGVSIGESGAENISTVQDAADLIEKVKTDA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G395140`
TK1151 ID	TkA03G395140
OH-1004 ID	LXL04_009050
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G395140`
Location	Chr03:98148910-98149790 (+)
Description	Similar to ACP1: Acyl carrier protein 1, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_009050` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009507 chloroplast Cellular Component GO:0000036 acyl carrier activity Molecular Function GO:0019904 protein domain specific binding Molecular Function GO:0031177 phosphopantetheine binding Molecular Function
KEGG gene cross-reference	ath:AT1G54580 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.988

Rank 1 · TkA03G395140 · TK1151

Mitochondrion0.019

Rank 2 · TkA03G395140 · TK1151

Nucleus0.014

Rank 3 · TkA03G395140 · TK1151

Cytoplasm0.011

Rank 4 · TkA03G395140 · TK1151

Cell membrane0.008

Rank 5 · TkA03G395140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00550PP-binding73-137 aa

PF23297ACP_SdgA_C73-137 aa

PF14573PP-binding_289-137 aa

PF16320Ribosomal_L12_N102-118 aa

PF16320Ribosomal_L12_N129-142 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G395140	`PF00550`	PP-binding	73	137	6.1e-12	46.3
TkA03G395140	`PF23297`	ACP_SdgA_C	73	137	7.7e-06	26.6
TkA03G395140	`PF14573`	PP-binding_2	89	137	3.6e-05	24.6
TkA03G395140	`PF16320`	Ribosomal_L12_N	102	118	0.041	14.3
TkA03G395140	`PF16320`	Ribosomal_L12_N	129	142	0.041	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card