TkA03G394470 | RubberDandelionOmics

Gene overview

TkA03G394470

Reference: TK1151 Chr: Chr03 Coordinates: 97947868-97950188 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1637 bp · TkA03G394470|TK1151|cDNA

AATAGTTTAAACCTATTCCAAAACCAATTCGAAACTCATTACGAATTTACGATCGACCTCAGTTCCACACCAGTTCTCCTAAATTATTCAAGAGCTACTTGCTAGATCATACAATGAGTTCAGAAATTTATGTTGAAGATGTCGAATCAGAAGCAGAGACCTGCGATTCCGATGATTCTCAAAATGACCCAAGCTTCGACATTTTAGAAGAGACTCAATCTAGATTCTCTAAACTCTCCCTCAAAAAGAAATCCAAATCT...

CDS

Download CDS FASTA

1344 bp · TkA03G394470|TK1151|CDS

ATGAGTTCAGAAATTTATGTTGAAGATGTCGAATCAGAAGCAGAGACCTGCGATTCCGATGATTCTCAAAATGACCCAAGCTTCGACATTTTAGAAGAGACTCAATCTAGATTCTCTAAACTCTCCCTCAAAAAGAAATCCAAATCTCGTATTCCCGAGAAAGTTGTTGATGATGTTGATTGTATAGAGATTACGGAGCCTAAGTTTGATGCAAATGATCAGAAAAGTTATGAGAACGTTCAAAAGATCATCGAAGTTGG...

Protein

Download Protein FASTA

447 aa · TkA03G394470|TK1151|PROTEIN

MSSEIYVEDVESEAETCDSDDSQNDPSFDILEETQSRFSKLSLKKKSKSRIPEKVVDDVDCIEITEPKFDANDQKSYENVQKIIEVGQVEKLKVEQCKLYLRKHGLRLTGKKDILIDRIKEHISIMNGEGEHKYPPFSFVMNCKGDACTGDIVMFEQNVYEMFSIASRSATGPPSGTRVVAGRIVKESYGAAKQQHTFTVEVLWSKGVKPLPPLHPLLIKGRNLYRLKTMRQRWKDESERQKILSEKHGRGNAARTNREA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G394470`
TK1151 ID	TkA03G394470
OH-1004 ID	LXL04_009041
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G394470

Location Chr03:97947868-97950188 (-)

Description Similar to Os10g0391300: Zinc finger CCCH domain-containing protein 62

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0391300`	Zinc finger CCCH domain-containing protein 62.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009041 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0003677 DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

dosa:Os10g0391300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.816

Rank 1 · TkA03G394470 · TK1151

Cytoplasm0.259

Rank 2 · TkA03G394470 · TK1151

Mitochondrion0.030

Rank 3 · TkA03G394470 · TK1151

Cell membrane0.026

Rank 4 · TkA03G394470 · TK1151

Endoplasmic reticulum0.014

Rank 5 · TkA03G394470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02037SAP89-123 aa

PF14608zf-CCCH_2141-148 aa

PF18345zf_CCCH_4144-149 aa

PF24766DUF7699148-234 aa

PF16131Torus257-282 aa

PF00642zf-CCCH424-447 aa

PF16131Torus425-447 aa

PF18044zf-CCCH_4428-447 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G394470	`PF02037`	SAP	89	123	1.6e-09	37.8
TkA03G394470	`PF14608`	zf-CCCH_2	141	148	8.6e-05	23.6
TkA03G394470	`PF18345`	zf_CCCH_4	144	149	3.8e-07	30.7
TkA03G394470	`PF24766`	DUF7699	148	234	2.8e-42	143.9
TkA03G394470	`PF16131`	Torus	257	282	0.0027	19.0
TkA03G394470	`PF00642`	zf-CCCH	424	447	9.6e-07	29.3
TkA03G394470	`PF16131`	Torus	425	447	0.0027	19.0
TkA03G394470	`PF18044`	zf-CCCH_4	428	447	7.8e-09	35.8
TkA03G394470	`PF14608`	zf-CCCH_2	428	447	8.6e-05	23.6
TkA03G394470	`PF18345`	zf_CCCH_4	429	447	3.8e-07	30.7
TkA03G394470	`PF25585`	zf-CCCH_DUS3L	429	447	0.016	15.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q338N2`	Oryza sativa subsp. japonica	sp\|Q338N2\|C3H62_ORYSJ Zinc finger CCCH domain-containing protein 62	49.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card