Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1657 bp · TkA03G389950|TK1151|cDNA
CTACTTTCACTCTTTCTTCCCTTCAACAATAGCTTTGTGTAGTCCGATGCTTCTATATCTTCCTCTATTTTCCATATATCAATCGCGTAACATGATCCCAAGAACCTAGATCTTTTTCACTCGCTGCTCCGGCGATCCTTCTTCACCGTCGACGAATCAAGATCCCAGTTATTTGGTGGTTTAGTTGAGAATTTCCATGGCGGATAACAATGTGAATTCCAGTTCACCTGCTGAAAACCAAAACCACAGCTCTGATGAGA...
1314 bp · TkA03G389950|TK1151|CDS
ATGGCGGATAACAATGTGAATTCCAGTTCACCTGCTGAAAACCAAAACCACAGCTCTGATGAGACCATAAACCCTATAACCAACCAGAGCGAGGTATCCATTGATGCAATCGCACAAAAGGTTCAAGAGTCTATGTCTATTTCCAAGAGGCATAAGTTTTGGGAAACTCAACCAGTTGGACAGTTTAAAGACGTTGGCAACCCAACCTTACCTGAAGGCCCAATTGAGCCTCCAACGCCATTATCAGAAGTTAAACAAGA...
Protein
Download Protein FASTA437 aa · TkA03G389950|TK1151|PROTEIN
MADNNVNSSSPAENQNHSSDETINPITNQSEVSIDAIAQKVQESMSISKRHKFWETQPVGQFKDVGNPTLPEGPIEPPTPLSEVKQEPYNLPGPYEWITCDMDTEEMCAEVYNLLANNYVEDDENMFRFNYSKDFLQWALRPPGYYRSWHIGVRVKSSKKLVAFITGVPAKIRAKDTIVNMAEINFLCVHKKLRSKRLAPVMIKEVTRRVHMENIWQAAYTAGVVLPTPISTCQYWHRSLNPKKLIDVGFSRLGARMTMS...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G389950 |
|---|---|
| TK1151 ID | TkA03G389950 |
| OH-1004 ID | LXL04_008257 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 93.593 / OH-1004 88.528Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G389950 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:96618285-96620681 (-) | |||||||||
| Description | Similar to NMT1: Glycylpeptide N-tetradecanoyltransferase 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006499 N-terminal protein myristoylation Biological Process GO:0010064 embryonic shoot morphogenesis Biological Process GO:0018008 N-terminal peptidyl-glycine N-myristoylation Biological Process GO:0022400 regulation of opsin-mediated signaling pathway Biological Process GO:0031669 cellular response to nutrient levels Biological Process GO:0042180 ketone metabolic process Biological Process GO:0072657 protein localization to membrane Biological Process GO:0150032 positive regulation of protein localization to lysosome Biological Process GO:1903749 positive regulation of establishment of protein localization to mitochondrion Biological Process GO:1904263 positive regulation of TORC1 signaling Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT5G57020 hsa:4836 mmu:18107 rno:259274 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01233NMT74-233 aaPF04708Pox_F16116-207 aaPF00583Acetyltransf_1125-209 aaPF13527Acetyltransf_9134-217 aaPF02799NMT_C247-427 aaPF00583Acetyltransf_1373-398 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G389950 | PF01233 | NMT | 74 | 233 | 1.9e-77 | 259.3 |
| TkA03G389950 | PF04708 | Pox_F16 | 116 | 207 | 0.074 | 13.2 |
| TkA03G389950 | PF00583 | Acetyltransf_1 | 125 | 209 | 0.08 | 13.9 |
| TkA03G389950 | PF13527 | Acetyltransf_9 | 134 | 217 | 0.081 | 13.6 |
| TkA03G389950 | PF02799 | NMT_C | 247 | 427 | 2.1e-78 | 263.3 |
| TkA03G389950 | PF00583 | Acetyltransf_1 | 373 | 398 | 0.08 | 13.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.