TkA03G382000 | RubberDandelionOmics

Gene overview

TkA03G382000

Reference: TK1151 Chr: Chr03 Coordinates: 94243057-94246788 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3227 bp · TkA03G382000|TK1151|cDNA

CCAACGGTCTACACACCACACACGCACCTGTAGGCTGTAGACAGACTCCAGTGAAATTCTGAACAAGAACAAATACAAGAAGTGCTAACGACAGCTCTTGATCTGAATTCGTGACGCCTTTCAAATCTCCCCATCTAAATTTCCAACGCAATCTATCGTTTTCTCGGTGAACATATAAATTCCAAGACCCCGCAATCTGTTATTCGTGTCTCGTTCTTAATTCCGTTTTCCTATTTCATTTCCCGATTTCCACATCTGTA...

CDS

Download CDS FASTA

2454 bp · TkA03G382000|TK1151|CDS

ATGGAGATGGACAACACTTCTCGCGGCAGATCATTCGATAGATCATCAAGAAACCCGGCGTCACTGAAGAAACCTCGATTGGTAACGGAAGAGCCAACGATTCTTCGCAGCACCAATAATCCAAACGGTAATAGTAGGCCTATAGTTCAACGGCAGTCAGTGGGGTTCCGGCCGGTGGTGGATAGAGATGGAGACTCCGAGTCGTATCAGCCACAATCGCTATCACAGATAAAACAGCAACAGCATCAAGAGCTTGTGAG...

Protein

Download Protein FASTA

817 aa · TkA03G382000|TK1151|PROTEIN

MEMDNTSRGRSFDRSSRNPASLKKPRLVTEEPTILRSTNNPNGNSRPIVQRQSVGFRPVVDRDGDSESYQPQSLSQIKQQQHQELVSQYRTALAELTFNSKPIITNLTIIAGENAQAAKAIAATICNNIIEVPRDQKLPSLYLLDSIVKNIGRDYIKHFSTRLPEVFCKAYRQVDSSLHSGMRHLFGTWKGVFPPQSLQSIEKELGFPTVTNGSSSGLTTSRPESQPPPQPPARSIHVNPKYLEARQKLQQSNRAKGDLP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G382000`
TK1151 ID	TkA03G382000
OH-1004 ID	LXL04_005052
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	97.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G382000

Location Chr03:94243057-94246788 (-)

Description Similar to PCFS4: Polyadenylation and cleavage factor homolog 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g04885`	Promotes flowering by suppressing FLC-mediated inhibition of flowering through the regulation of FCA pre-mRNA alternative processing.	Arabidopsis PCFS4, a homologue of yeast polyadenylation factor Pcf11p, regulates FCA alternative processing and promotes flowering time.2008 · DOI: 10.1111/j.1365-313x.2008.03455.x Ratio-based analysis of differential mRNA processing and expression of a polyadenylation factor mutant pcfs4 using arabidopsis tiling microarray.2011 · DOI: 10.1371/journal.pone.0014719

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005052 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006369 termination of RNA polymerase II transcription Biological Process

GO:0006397 mRNA processing Biological Process

GO:0009908 flower development Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0031124 mRNA 3'-end processing Biological Process

GO:0031440 regulation of mRNA 3'-end processing Biological Process

GO:0180010 co-transcriptional mRNA 3'-end processing, cleavage and polyadenylation pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005849 mRNA cleavage factor complex Cellular Component

KEGG gene cross-reference

ath:AT1G66500

ath:AT4G04885

hsa:51585

mmu:74737

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.840

Rank 1 · TkA03G382000 · TK1151

Cytoplasm0.260

Rank 2 · TkA03G382000 · TK1151

Cell membrane0.022

Rank 3 · TkA03G382000 · TK1151

Mitochondrion0.016

Rank 4 · TkA03G382000 · TK1151

Endoplasmic reticulum0.014

Rank 5 · TkA03G382000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04818CID91-200 aa

PF13634Nucleoporin_FG287-323 aa

PF13634Nucleoporin_FG526-579 aa

PF21936Pcf11_C664-679 aa

PF23228zf_PCFS4673-684 aa

PF13894zf-C2H2_4674-696 aa

PF00096zf-C2H2674-696 aa

PF30018zf-C2H2_ATbp_2nd679-694 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G382000	`PF04818`	CID	91	200	1.8e-14	54.7
TkA03G382000	`PF13634`	Nucleoporin_FG	287	323	1.9	10.1
TkA03G382000	`PF13634`	Nucleoporin_FG	526	579	1.9	10.1
TkA03G382000	`PF21936`	Pcf11_C	664	679	0.23	12.1
TkA03G382000	`PF23228`	zf_PCFS4	673	684	3e-22	78.8
TkA03G382000	`PF13894`	zf-C2H2_4	674	696	0.0035	18.6
TkA03G382000	`PF00096`	zf-C2H2	674	696	0.047	14.9
TkA03G382000	`PF30018`	zf-C2H2_ATbp_2nd	679	694	0.14	12.6
TkA03G382000	`PF23228`	zf_PCFS4	743	798	3e-22	78.8
TkA03G382000	`PF21936`	Pcf11_C	751	777	0.23	12.1
TkA03G382000	`PF13894`	zf-C2H2_4	754	765	0.0035	18.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WPF2`	Arabidopsis thaliana	sp\|Q0WPF2\|PCFS4_ARATH Polyadenylation and cleavage factor homolog 4	31.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card