LXL04_005052 | RubberDandelionOmics

Gene overview

LXL04_005052

Reference: OH-1004 Chr: Chr01 Coordinates: 153853226-153856190 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2457 bp · LXL04_005052|LXL04_005052|OH1004|cDNA

ATGGAGATGGACAACACTTCTCGCGGCAGATCATTCGATAGATCATCAAGAAACCCGGCGTCACTGAAGAAACCTCGATTGGTAACGGAAGAGCCAACGATTCTTCGCAGCACCAATAATCCAAACGGTAATAGTAGGCCTATAGTTCAACGGCAGTCAGTGGGGTTCCGGCCGGTGGTGGATAGAGATGGAGACTCCGAGTCGTATCAGCCACAATCGCTATCACAGATAAAACAGCAACAGCATCAAGAGCTTGTGAG...

CDS

Download CDS FASTA

2457 bp · LXL04_005052|LXL04_005052|OH1004|CDS

ATGGAGATGGACAACACTTCTCGCGGCAGATCATTCGATAGATCATCAAGAAACCCGGCGTCACTGAAGAAACCTCGATTGGTAACGGAAGAGCCAACGATTCTTCGCAGCACCAATAATCCAAACGGTAATAGTAGGCCTATAGTTCAACGGCAGTCAGTGGGGTTCCGGCCGGTGGTGGATAGAGATGGAGACTCCGAGTCGTATCAGCCACAATCGCTATCACAGATAAAACAGCAACAGCATCAAGAGCTTGTGAG...

Protein

Download Protein FASTA

818 aa · LXL04_005052|LXL04_005052|OH1004|PROTEIN

MEMDNTSRGRSFDRSSRNPASLKKPRLVTEEPTILRSTNNPNGNSRPIVQRQSVGFRPVVDRDGDSESYQPQSLSQIKQQQHQELVSQYRTALAELTFNSKPIITNLTIIAGENAQAAKAIAATICNNIIEVPRDQKLPSLYLLDSIVKNIGRDYIKHFSTRLPEVFCKAYRQVDSSLHSGMRHLFGTWKGVFPPQSLQSIEKELGFPTVTNGSSSGLTTSRPESQPPPQPPARSIHVNPKYLEARQKLQQSNRAKGDLP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005052`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005052

Location Chr01:153853226-153856190 (-)

Description Similar to PCFS4: Polyadenylation and cleavage factor homolog 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g04885`	Promotes flowering by suppressing FLC-mediated inhibition of flowering through the regulation of FCA pre-mRNA alternative processing.	Arabidopsis PCFS4, a homologue of yeast polyadenylation factor Pcf11p, regulates FCA alternative processing and promotes flowering time.2008 · DOI: 10.1111/j.1365-313x.2008.03455.x Ratio-based analysis of differential mRNA processing and expression of a polyadenylation factor mutant pcfs4 using arabidopsis tiling microarray.2011 · DOI: 10.1371/journal.pone.0014719
`At1g66500`	Polyadenylation and cleavage factor homolog 1.	No verified direct reference in this release
`At5g43620`	Polyadenylation and cleavage factor homolog 5.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005052 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006369 termination of RNA polymerase II transcription Biological Process

GO:0006397 mRNA processing Biological Process

GO:0009908 flower development Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0031124 mRNA 3'-end processing Biological Process

GO:0031440 regulation of mRNA 3'-end processing Biological Process

GO:0180010 co-transcriptional mRNA 3'-end processing, cleavage and polyadenylation pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005849 mRNA cleavage factor complex Cellular Component

KEGG gene cross-reference

ath:AT1G66500

ath:AT4G04885

hsa:51585

mmu:74737

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.851

Rank 1 · LXL04_005052 · OH-1004

Cytoplasm0.255

Rank 2 · LXL04_005052 · OH-1004

Cell membrane0.022

Rank 3 · LXL04_005052 · OH-1004

Mitochondrion0.016

Rank 4 · LXL04_005052 · OH-1004

Endoplasmic reticulum0.013

Rank 5 · LXL04_005052 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04818.20CID91-200 aa

PF23228.2zf_PCFS4744-799 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005052	`PF04818.20`	CID	91	200	1.9e-14	54.6
LXL04_005052	`PF23228.2`	zf_PCFS4	744	799	7.3e-22	77.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WPF2`	Arabidopsis thaliana	Polyadenylation and cleavage factor homolog 4	41.424%	Swiss-Prot	weak database homology
`Q9C710`	Arabidopsis thaliana	Polyadenylation and cleavage factor homolog 1	34.320%	Swiss-Prot	weak database homology
`Q9FIX8`	Arabidopsis thaliana	Polyadenylation and cleavage factor homolog 5	35.196%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card