TkA03G359660 | RubberDandelionOmics

Gene overview

TkA03G359660

Reference: TK1151 Chr: Chr03 Coordinates: 88751458-88755050 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2087 bp · TkA03G359660|TK1151|cDNA

CGAAATTATACGGATGATCCCATATGCGCACGTTAGCTGCTGAACCGGCAACGTCTTTTTGCCAACAAATTTTAAAGCGGTAATCCAAAAAAGCGGTTCAGAAACCATGTCGTGTGCCGTCTCCCTCCATTTTCTTAAATGCAACTTCTCCCGACATTTCAGAGTTCATCACACACCTTGACCCGCTTCGCTCTTTCATGCTTTGATAAAAACCCGAATATGACATCCGGGTCGAACTCGTTGATGTGGTTCAGGAAGGG...

CDS

Download CDS FASTA

1695 bp · TkA03G359660|TK1151|CDS

ATGCAACTTCTCCCGACATTTCAGAGTTCATCACACACCTTGACCCGCTTCGCTCTTTCATGCTTTGATAAAAACCCGAATATGACATCCGGGTCGAACTCGTTGATGTGGTTCAGGAAGGGTCTCCGGATCCACGACAACCAAGCCCTTGAATACGCTGCAAAAGACTGTAACTATGTCTACCCTGTTTTCGTCATCGACCCTCATTACATGAAACCCGACCCGGCCGCGTTCTCTCCGGGTTCAAACCTTGCAGGGTT...

Protein

Download Protein FASTA

564 aa · TkA03G359660|TK1151|PROTEIN

MQLLPTFQSSSHTLTRFALSCFDKNPNMTSGSNSLMWFRKGLRIHDNQALEYAAKDCNYVYPVFVIDPHYMKPDPAAFSPGSNLAGLTRIRFLLESLLDLDSSLRKLGSRLLVLHGEPSDVVIRCLKEWDIKRLCFEYDTDPYYQALDAKVKNYASESGIDVFTPVSHTLFNPAEIIEKNGGKPPLSYQSFLKLAGEPNWSISSLSTTLSVIPPIGDLGNCEVSEVPTVEELGYEDIQEVDPPLFKGGESEALRRLQEST...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G359660`
TK1151 ID	TkA03G359660
OH-1004 ID	LXL04_008552
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G359660

Location Chr03:88751458-88755050 (-)

Description Similar to UVR3: (6-4)DNA photolyase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g15620`	Involved in repair of UV radiation-induced DNA damage.	Cloning and characterization of a gene (UVR3) required for photorepair of 6-4 photoproducts in Arabidopsis thaliana.1998 · DOI: 10.1093/nar/26.2.638

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0204400`	Involved in repair of UV radiation-induced DNA damage.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008552 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006094 gluconeogenesis Biological Process

GO:0006111 regulation of gluconeogenesis Biological Process

GO:0006281 DNA repair Biological Process

GO:0006290 pyrimidine dimer repair Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009411 response to UV Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0014823 response to activity Biological Process

GO:0019915 lipid storage Biological Process

GO:0031397 negative regulation of protein ubiquitination Biological Process

KEGG gene cross-reference

ath:AT3G15620

dosa:Os02g0204400

rno:299691

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.328

Rank 1 · TkA03G359660 · TK1151

Mitochondrion0.255

Rank 2 · TkA03G359660 · TK1151

Nucleus0.229

Rank 3 · TkA03G359660 · TK1151

Plastid0.120

Rank 4 · TkA03G359660 · TK1151

Cell membrane0.077

Rank 5 · TkA03G359660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00875DNA_photolyase34-194 aa

PF03441FAD_binding_7323-520 aa

PF13056DUF3918521-546 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G359660	`PF00875`	DNA_photolyase	34	194	1.8e-41	142.6
TkA03G359660	`PF03441`	FAD_binding_7	323	520	3.8e-72	242.7
TkA03G359660	`PF13056`	DUF3918	521	546	0.015	15.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O48652`	Arabidopsis thaliana	sp\|O48652\|UVR3_ARATH (6-4)DNA photolyase	72.200%	Swiss-Prot	High
`Q0E2Y1`	Oryza sativa subsp. japonica	sp\|Q0E2Y1\|UVR3_ORYSJ (6-4)DNA photolyase	69.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card