Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1695 bp · LXL04_008552|LXL04_008552|OH1004|cDNA
ATGCAACTTCTCCCGACATTTCAGAGTTCATCACACACCTTGACCCGCTTCGCTCTTTCATGCTTTGATAAAAACCCGAATATGACATCCGGGTCGAACTCGTTGATGTGGTTCAGGAAGGGTCTCCGGATCCACGACAACCAAGCCCTTGAATACGCTGCAAAAGACTGTAACTATGTCTACCCTGTTTTCGTCATCGACCCTCATTACATGAAACCCGACCCGGCCGCGTTCTCTCCGGGTTCAAACCTTGCAGGGTT...
1695 bp · LXL04_008552|LXL04_008552|OH1004|CDS
ATGCAACTTCTCCCGACATTTCAGAGTTCATCACACACCTTGACCCGCTTCGCTCTTTCATGCTTTGATAAAAACCCGAATATGACATCCGGGTCGAACTCGTTGATGTGGTTCAGGAAGGGTCTCCGGATCCACGACAACCAAGCCCTTGAATACGCTGCAAAAGACTGTAACTATGTCTACCCTGTTTTCGTCATCGACCCTCATTACATGAAACCCGACCCGGCCGCGTTCTCTCCGGGTTCAAACCTTGCAGGGTT...
Protein
Download Protein FASTA564 aa · LXL04_008552|LXL04_008552|OH1004|PROTEIN
MQLLPTFQSSSHTLTRFALSCFDKNPNMTSGSNSLMWFRKGLRIHDNQALEYAAKDCNYVYPVFVIDPHYMKPDPAAFSPGSNLAGLTRIRFLLESLLDLDSSLRKLGSRLLVLHGEPSDVVIRCLKEWDIKRLCFEYDTDPYYQALDAKVKNYASESGIDVFTPVSHTLFNPAEIIEKNGGKPPLSYQSFLKLAGEPNWSISSLSTTLSVIPPIGDLGNCEVSEVPTVEELGYEDIQEVDPPLFKGGESEALRRLQEST...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_008552 |
|---|---|
| TK1151 ID | TkA03G359660 |
| OH-1004 ID | LXL04_008552 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_008552 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:102571232-102574433 (+) | ||||||||||||
| Description | Similar to UVR3: (6-4)DNA photolyase | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0006094 gluconeogenesis Biological Process GO:0006111 regulation of gluconeogenesis Biological Process GO:0006281 DNA repair Biological Process GO:0006290 pyrimidine dimer repair Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0007623 circadian rhythm Biological Process GO:0009411 response to UV Biological Process GO:0009416 response to light stimulus Biological Process GO:0014823 response to activity Biological Process GO:0019915 lipid storage Biological Process GO:0031397 negative regulation of protein ubiquitination Biological Process | ||||||||||||
| KEGG gene cross-reference | ath:AT3G15620 dosa:Os02g0204400 rno:299691 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00875.25DNA_photolyase34-194 aaPF03441.20FAD_binding_7323-520 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_008552 | PF00875.25 | DNA_photolyase | 34 | 194 | 1.8e-41 | 142.6 |
| LXL04_008552 | PF03441.20 | FAD_binding_7 | 323 | 520 | 3.8e-72 | 242.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.