TkA03G352300 | RubberDandelionOmics

Gene overview

TkA03G352300

Reference: TK1151 Chr: Chr03 Coordinates: 86777907-86782573 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1963 bp · TkA03G352300|TK1151|cDNA

GCATTAAAGAATCATAGCACTATATTCTATAGGAAGATCATCTCAAGTTTTCATAATAATATGGACCAAGAAAGCCAAATCAGCAAATCTAGCATGTATGTCAATTGGAGAAACAAACCAGCTATAGAAGGCCAACATGGTGGCATACTTGCAGCCTCTTTTGTCTTAGTTGTGGAGGTACTGGAGAATCTAGCATACTTGGCGAATGCAAGCAACCTTGTTTTGTATTTGTCAAAATTCATGCATTATTCACCATCAAG...

CDS

Download CDS FASTA

1716 bp · TkA03G352300|TK1151|CDS

ATGGACCAAGAAAGCCAAATCAGCAAATCTAGCATGTATGTCAATTGGAGAAACAAACCAGCTATAGAAGGCCAACATGGTGGCATACTTGCAGCCTCTTTTGTCTTAGTTGTGGAGGTACTGGAGAATCTAGCATACTTGGCGAATGCAAGCAACCTTGTTTTGTATTTGTCAAAATTCATGCATTATTCACCATCAAGTTCTTCAAACATCGTTAGCAATTTCATGGGCACAGCATTCCTCCTTGCTCTTCTTGGTGG...

Protein

Download Protein FASTA

571 aa · TkA03G352300|TK1151|PROTEIN

MDQESQISKSSMYVNWRNKPAIEGQHGGILAASFVLVVEVLENLAYLANASNLVLYLSKFMHYSPSSSSNIVSNFMGTAFLLALLGGFLADAFFTTYCIYLISATIELVGLLILTMQARSRSLKPESCLSINRNTKCEGTEGGKEALLFIGLYLVALGVGGIKGSLPPHGAEQFDEKSIEGRKKRSSFFNYYVFCLACGALIAVTFAVWIEDNKGWQWGFGISTLAILISIPIFLLGSTVYRIKVPSGSPITTIFKVLTA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G352300`
TK1151 ID	TkA03G352300
OH-1004 ID	LXL04_008622
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 95.645 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G352300

Location Chr03:86777907-86782573 (-)

Description Similar to NPF4.6: Protein NRT1/ PTR FAMILY 4.6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g69850`	Low-affinity proton-dependent nitrate transporter.	Identification of an abscisic acid transporter by functional screening using the receptor complex as a sensor.2012 · DOI: 10.1073/pnas.1203567109 Nitrate does not compete with abscisic acid as a substrate of AtNPF4.6/NRT1.2/AIT1 in Arabidopsis.2013 · DOI: 10.4161/psb.26624
`At1g27040`	Involved in abscisic acid transport.	No verified direct reference in this release
`At5g62730`	Protein NRT1/ PTR FAMILY 4.7.	No verified direct reference in this release
`At3g25260`	Involved in (+) and (-)-abscisic acid transport (ABA) and in gibberellin import.	No verified direct reference in this release
`At3g25280`	Involved in abscisic acid transport.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008622 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009624 response to nematode Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0042128 nitrate assimilation Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0080168 abscisic acid transport Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0015293 symporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G27040

ath:AT1G69850

ath:AT3G25260

ath:AT3G25280

ath:AT5G62730

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.716

Rank 1 · TkA03G352300 · TK1151

Endoplasmic reticulum0.093

Rank 2 · TkA03G352300 · TK1151

Lysosome / Vacuole0.092

Rank 3 · TkA03G352300 · TK1151

Cytoplasm0.075

Rank 4 · TkA03G352300 · TK1151

Mitochondrion0.036

Rank 5 · TkA03G352300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07690MFS_149-393 aa

PF15817TMEM4088-110 aa

PF00854PTR2101-511 aa

PF15817TMEM40182-244 aa

PF07690MFS_1412-545 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G352300	`PF07690`	MFS_1	49	393	4.7e-06	26.5
TkA03G352300	`PF15817`	TMEM40	88	110	0.21	12.1
TkA03G352300	`PF00854`	PTR2	101	511	1.9e-101	340.5
TkA03G352300	`PF15817`	TMEM40	182	244	0.21	12.1
TkA03G352300	`PF07690`	MFS_1	412	545	4.7e-06	26.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H157`	Arabidopsis thaliana	sp\|Q8H157\|PTR19_ARATH Protein NRT1/ PTR FAMILY 4.6	64.200%	Swiss-Prot	High
`Q8VYE4`	Arabidopsis thaliana	sp\|Q8VYE4\|PTR12_ARATH Protein NRT1/ PTR FAMILY 4.5	64.500%	Swiss-Prot	High
`Q9FM20`	Arabidopsis thaliana	sp\|Q9FM20\|PTR54_ARATH Protein NRT1/ PTR FAMILY 4.7	63.200%	Swiss-Prot	High
`Q9LSF0`	Arabidopsis thaliana	sp\|Q9LSF0\|PTR34_ARATH Protein NRT1/ PTR FAMILY 4.1	39.100%	Swiss-Prot	Medium
`Q9LSE8`	Arabidopsis thaliana	sp\|Q9LSE8\|PTR35_ARATH Protein NRT1/ PTR FAMILY 4.2	39.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card