TkA03G314330 | RubberDandelionOmics

Gene overview

TkA03G314330

Reference: TK1151 Chr: Chr03 Coordinates: 77188151-77190745 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

999 bp · TkA03G314330|TK1151|cDNA

ATGGCATCGACGCAAGGTAGATTACAACCGAGGAAATCGACTTCGAAATATGCGAATTCGCCCTCGTCTTCAACTACTTCGTCTTCGAAACATTTTCCTGAAGCTTCTGTGGATAATCTGAGCTCTCCGACTTCATCTGCTAGAAGCAAGCCGCATTATTTTTACTCCGAGAGTTTGCCATTGGGTACCGAGAGATCGAAGGAGAATGTCACTGTTACTGTACGGTTCCGGCCTCTCAGTCCGAGGGAAATTCGACGAGG...

CDS

Download CDS FASTA

999 bp · TkA03G314330|TK1151|CDS

ATGGCATCGACGCAAGGTAGATTACAACCGAGGAAATCGACTTCGAAATATGCGAATTCGCCCTCGTCTTCAACTACTTCGTCTTCGAAACATTTTCCTGAAGCTTCTGTGGATAATCTGAGCTCTCCGACTTCATCTGCTAGAAGCAAGCCGCATTATTTTTACTCCGAGAGTTTGCCATTGGGTACCGAGAGATCGAAGGAGAATGTCACTGTTACTGTACGGTTCCGGCCTCTCAGTCCGAGGGAAATTCGACGAGG...

Protein

Download Protein FASTA

332 aa · TkA03G314330|TK1151|PROTEIN

MASTQGRLQPRKSTSKYANSPSSSTTSSSKHFPEASVDNLSSPTSSARSKPHYFYSESLPLGTERSKENVTVTVRFRPLSPREIRRGEEIAWYADGETILRNEENPSIAYAYDRVFGPTTTTRHVYDIAAQHVVSGAMEGVNGTIFTYGVTSSGKTHTMHGDKRSPGIIPLAIKDYSLSYKTPDHEFLLRVSYLEIYNEVVNDLLNPAGQNLRIREDNQGAFVEGKKEEVVLSPAHALSLIAAGEADEMMALQAAMDNRV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G314330`
TK1151 ID	TkA03G314330
OH-1004 ID	LXL04_032877
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	94.300
Protein coverage (%)	TK1151 73.795 / OH-1004 28.050 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G314330

Location Chr03:77188151-77190745 (+)

Description Similar to KIN7K: Kinesin-like protein KIN-7K, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12020`	Kinesin-like protein KIN-7K, chloroplastic.	No verified direct reference in this release
`At5g06670`	Kinesin-like protein KIN-7L, chloroplastic.	No verified direct reference in this release
`At1g21730`	Kinesin-like protein KIN-7C, mitochondrial.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0775400`	Probable minus end-directed motor protein with a microtubule-enhanced ATPase activity.	No verified direct reference in this release
`Os04g0434600`	Kinesin-like protein KIN-7E, chloroplastic.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032877 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007018 microtubule-based movement Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005871 kinesin complex Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0003777 microtubule motor activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008017 microtubule binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference

ath:AT3G12020

ath:AT5G06670

osa:9271714

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.542

Rank 1 · TkA03G314330 · TK1151

Nucleus0.339

Rank 2 · TkA03G314330 · TK1151

Cell membrane0.101

Rank 3 · TkA03G314330 · TK1151

Plastid0.080

Rank 4 · TkA03G314330 · TK1151

Mitochondrion0.058

Rank 5 · TkA03G314330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03004Transposase_247-28 aa

PF16796Microtub_bd69-205 aa

PF00225Kinesin75-251 aa

PF14167YfkD100-133 aa

PF30059DIA2_190-228 aa

PF14167YfkD241-272 aa

PF03004Transposase_24262-310 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G314330	`PF03004`	Transposase_24	7	28	7.5e-06	26.9
TkA03G314330	`PF16796`	Microtub_bd	69	205	6.7e-17	62.5
TkA03G314330	`PF00225`	Kinesin	75	251	4.1e-42	145.1
TkA03G314330	`PF14167`	YfkD	100	133	0.3	11.0
TkA03G314330	`PF30059`	DIA2_	190	228	0.0054	17.2
TkA03G314330	`PF14167`	YfkD	241	272	0.3	11.0
TkA03G314330	`PF03004`	Transposase_24	262	310	7.5e-06	26.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4J8L3`	Arabidopsis thaliana	sp\|F4J8L3\|KN7K_ARATH Kinesin-like protein KIN-7K, chloroplastic	76.100%	Swiss-Prot	High
`F4K3X8`	Arabidopsis thaliana	sp\|F4K3X8\|KN7L_ARATH Kinesin-like protein KIN-7L, chloroplastic	78.000%	Swiss-Prot	Medium
`Q8W5R6`	Arabidopsis thaliana	sp\|Q8W5R6\|KN7C_ARATH Kinesin-like protein KIN-7C, mitochondrial	76.700%	Swiss-Prot	Medium
`Q6YZ52`	Oryza sativa subsp. japonica	sp\|Q6YZ52\|KN7D_ORYSJ Kinesin-like protein KIN-7D, chloroplastic	86.100%	Swiss-Prot	Medium
`B9FFA3`	Oryza sativa subsp. japonica	sp\|B9FFA3\|KN7E_ORYSJ Kinesin-like protein KIN-7E, chloroplastic	78.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card