TkA03G287420 | RubberDandelionOmics

Gene overview

TkA03G287420

Reference: TK1151 Chr: Chr03 Coordinates: 70945103-70950917 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2732 bp · TkA03G287420|TK1151|cDNA

TAGCAGTTTAGTTTGTGGAGGAAAGTCTCATGATCAACCAATTAGATCAATTTTGAAAAGTGAAGATATGAACATTGTTTTACTTGGAACTTTAAAGATTTCTGAAAGATCTGGAAGGTTGCAGTTGGTTGATGCAACAGGCAGCATTGACATTGTCATACCTGATCTTCCAACTGTTTGGAGCAATAACGACATATATGAGATAAATGACTTCAGCATTGTAATGGAAGGATTCCCTAGACAACTACAAGGTTTAGAAT...

CDS

Download CDS FASTA

2775 bp · TkA03G287420|TK1151|CDS

ATGGAAGAAGAGAGTTCAGTGAAACTCATTTCGGTCTCCGACCTACTCCACCGTCTCCACCCCCTCACCGGCGCATCGTTATTTACGCCCAGCCATTCCGTTCGTCGTGCTCCTTCATACAAAGACGCACCCCAGCCGTCAAATCCACAAAACCCTAACAGTCTTAAAATCCTTAAACCTCTTAACTACCCAACAGTACTCGTCGGAACCCTAAATCTAACCTTCCCCTCCTCATCTTGCTCTAATTCAAGTTGCCTGAA...

Protein

Download Protein FASTA

924 aa · TkA03G287420|TK1151|PROTEIN

MEEESSVKLISVSDLLHRLHPLTGASLFTPSHSVRRAPSYKDAPQPSNPQNPNSLKILKPLNYPTVLVGTLNLTFPSSSCSNSSCLKFCDHSAAVCCDILDLDLRVIGQRIRIVAWNFLPLKPHGGFLEIIRWSLDQSEESYVSKFNAFYLNSVIPTHEETIVPRHLIYGLLESVSPVSNVPCTSNKTGTKNVKGFQAEITTCECKLCISRDKVMLLHDNPTEQSNSHKFSKSTILYFCGSASIWYPVISRLVGSILLIS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G287420`
TK1151 ID	TkA03G287420
OH-1004 ID	LXL04_008206
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.800
Protein coverage (%)	TK1151 98.485 / OH-1004 83.219 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G287420

Location Chr03:70945103-70950917 (-)

Description Similar to CTC1: CST complex subunit CTC1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g09680`	Component of the CST complex, a complex that binds to single-stranded DNA and is required to protect telomeres from DNA degradation.	Conserved telomere maintenance component 1 interacts with STN1 and maintains chromosome ends in higher eukaryotes.2009 · DOI: 10.1016/j.molcel.2009.09.017 POT1a and components of CST engage telomerase and regulate its activity in Arabidopsis.2014 · DOI: 10.1371/journal.pgen.1004738

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008206 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0010833 telomere maintenance via telomere lengthening Biological Process

GO:0045740 positive regulation of DNA replication Biological Process

GO:0000781 chromosome, telomeric region Cellular Component

GO:0005634 nucleus Cellular Component

GO:1990879 CST complex Cellular Component

GO:0003697 single-stranded DNA binding Molecular Function

GO:0042162 telomeric DNA binding Molecular Function

KEGG gene cross-reference

ath:AT4G09680

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.910

Rank 1 · TkA03G287420 · TK1151

Cytoplasm0.118

Rank 2 · TkA03G287420 · TK1151

Cell membrane0.047

Rank 3 · TkA03G287420 · TK1151

Endoplasmic reticulum0.033

Rank 4 · TkA03G287420 · TK1151

Plastid0.014

Rank 5 · TkA03G287420 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15491CTC1_N_plant10-135 aa

PF15489CTC1_1st66-130 aa

PF30826CTC1_2nd_plant165-285 aa

PF29129YLR108C_C168-230 aa

PF30827CTC1_3rd315-437 aa

PF15489CTC1_1st496-522 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G287420	`PF15491`	CTC1_N_plant	10	135	1.1e-36	126.8
TkA03G287420	`PF15489`	CTC1_1st	66	130	0.024	14.9
TkA03G287420	`PF30826`	CTC1_2nd_plant	165	285	1.3e-33	116.3
TkA03G287420	`PF29129`	YLR108C_C	168	230	0.16	12.0
TkA03G287420	`PF30827`	CTC1_3rd	315	437	8.7e-07	29.6
TkA03G287420	`PF15489`	CTC1_1st	496	522	0.024	14.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`D0EL35`	Arabidopsis thaliana	sp\|D0EL35\|CTC1_ARATH CST complex subunit CTC1	33.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card