TkA03G175120 | RubberDandelionOmics

Gene overview

TkA03G175120

Reference: TK1151 Chr: Chr03 Coordinates: 44153791-44156344 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1454 bp · TkA03G175120|TK1151|cDNA

CAAAAGGTCTCATTTCGTTCCATTTGTTCCACTTCCACATCGATGTTGACCTCTACGGTACAATGATCGATTTAACTACTCCAGATCACCAGATGTCGCCAATTTCGGCACCTTAGGTCTAAGGTCTGCATGATCTTGTCTATAAGCAATGGGATTAACTGGTTGCCACCAAACAACCTTTACCAGCTGGATCCAAATAAACACTGGTGATTTAGGTTCAATTACAACTACAACATCAAGGAAACATCATTTGTCATTAC...

CDS

Download CDS FASTA

1020 bp · TkA03G175120|TK1151|CDS

ATGGGATTAACTGGTTGCCACCAAACAACCTTTACCAGCTGGATCCAAATAAACACTGGTGATTTAGGTTCAATTACAACTACAACATCAAGGAAACATCATTTGTCATTACCATATAATCATTATGGATTCTATAAAACATCACTAAGAACAATGCCCAAATATTGTTCTTCACTTTGTGATCCAAGCACAGTATCCATCCACACCAAGAACACCGAACCATTGAGACTGACAAATGAGTCAACTCTGATCATAATAAG...

Protein

Download Protein FASTA

339 aa · TkA03G175120|TK1151|PROTEIN

MGLTGCHQTTFTSWIQINTGDLGSITTTTSRKHHLSLPYNHYGFYKTSLRTMPKYCSSLCDPSTVSIHTKNTEPLRLTNESTLIIIRHGESMWNEKNLFTGCVDVPLTRKGVEEAIEAGKRISTMPFDIVYTSALVRSQMTAMLALTQHCCQKVPIIIHEENEEAKIRSQMYSEDTKSQCIPVVKAWQLNERMYGDLQGLNKQETAEIFGKEQVYRWRRTYEVQPPNGESLEMCLKRAVAFFKDNIEPQLMDGKHVMVVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G175120`
TK1151 ID	TkA03G175120
OH-1004 ID	LXL04_007435
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 96.307 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G175120

Location Chr03:44153791-44156344 (+)

Description Similar to gpmA: 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase (Protochlamydia amoebophila (strain UWE25)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22170`	Catalyzes the interconversion of 2-phosphoglycerate and 3-phosphoglycerate.	No verified direct reference in this release
`At1g78050`	Catalyzes the interconversion of 2-phosphoglycerate and 3-phosphoglycerate.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007435 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006094 gluconeogenesis Biological Process

GO:0006096 glycolytic process Biological Process

GO:0010167 response to nitrate Biological Process

GO:0061621 canonical glycolysis Biological Process

GO:0080033 response to nitrite Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0004619 phosphoglycerate mutase activity Molecular Function

KEGG gene cross-reference

ath:AT1G22170

ath:AT1G78050

cca:CCA_00904

cfe:CF0110

pcu:PC_RS00790

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.951

Rank 1 · TkA03G175120 · TK1151

Mitochondrion0.070

Rank 2 · TkA03G175120 · TK1151

Cytoplasm0.029

Rank 3 · TkA03G175120 · TK1151

Nucleus0.023

Rank 4 · TkA03G175120 · TK1151

Peroxisome0.017

Rank 5 · TkA03G175120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00300His_Phos_183-161 aa

PF00300His_Phos_1181-288 aa

PF08506Cse1239-282 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G175120	`PF00300`	His_Phos_1	83	161	6.1e-35	121.4
TkA03G175120	`PF00300`	His_Phos_1	181	288	6.1e-35	121.4
TkA03G175120	`PF08506`	Cse1	239	282	0.22	11.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LM13`	Arabidopsis thaliana	sp\|Q9LM13\|GPMA1_ARATH 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 1	69.800%	Swiss-Prot	High
`F4I8M8`	Arabidopsis thaliana	sp\|F4I8M8\|GPMA2_ARATH 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2	66.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card