LXL04_007435 | RubberDandelionOmics

Gene overview

LXL04_007435

Reference: OH-1004 Chr: Chr02 Coordinates: 48506261-48508869 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1059 bp · LXL04_007435|LXL04_007435|OH1004|cDNA

ATGGGATTAACTGGTTGCCACCAAACAACCTTTACCAGCTGGATCCAAATAAACACTGGTGACTTAGGTTCAAGTACAACTACAACATCAAGGAAACATCATTTGTCATTACCATATAATCATTATGGATTCTATAAAACATCACTAAGAACAATGCCCAAATATTGTTCTTCACTTTGTGATCCAAGCACAGTATCCATCCACACCAAGAACACCGAACCATTGAGACTGACAAATGAGTCAACTCTGATCATAATAAG...

CDS

Download CDS FASTA

1059 bp · LXL04_007435|LXL04_007435|OH1004|CDS

ATGGGATTAACTGGTTGCCACCAAACAACCTTTACCAGCTGGATCCAAATAAACACTGGTGACTTAGGTTCAAGTACAACTACAACATCAAGGAAACATCATTTGTCATTACCATATAATCATTATGGATTCTATAAAACATCACTAAGAACAATGCCCAAATATTGTTCTTCACTTTGTGATCCAAGCACAGTATCCATCCACACCAAGAACACCGAACCATTGAGACTGACAAATGAGTCAACTCTGATCATAATAAG...

Protein

Download Protein FASTA

352 aa · LXL04_007435|LXL04_007435|OH1004|PROTEIN

MGLTGCHQTTFTSWIQINTGDLGSSTTTTSRKHHLSLPYNHYGFYKTSLRTMPKYCSSLCDPSTVSIHTKNTEPLRLTNESTLIIIRHGESMWNEKNLFTGCVDVPLTRKGVEEAIEAGKRISTMPFDIVYTSALVRSQMTAMLALTQHCCQKVPIIIHEENEEAKIRSQMYSEDTKSQCIPVVKAWQLNERMYGDLQGLNKQETAEIFGKEQVYRWRRTYEVQPPNGESLEMCLKRAVAFFKDNIEPQLMDGKHVMVVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007435`
TK1151 ID	TkA03G175120
OH-1004 ID	LXL04_007435
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 96.307 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007435

Location Chr02:48506261-48508869 (+)

Description Similar to gpmA: 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase (Protochlamydia amoebophila (strain UWE25)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22170`	Catalyzes the interconversion of 2-phosphoglycerate and 3-phosphoglycerate.	No verified direct reference in this release
`At1g78050`	Catalyzes the interconversion of 2-phosphoglycerate and 3-phosphoglycerate.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007435 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006094 gluconeogenesis Biological Process

GO:0006096 glycolytic process Biological Process

GO:0010167 response to nitrate Biological Process

GO:0061621 canonical glycolysis Biological Process

GO:0080033 response to nitrite Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0004619 phosphoglycerate mutase activity Molecular Function

KEGG gene cross-reference

ath:AT1G22170

ath:AT1G78050

cca:CCA_00904

cfe:CF0110

pcu:PC_RS00790

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.952

Rank 1 · LXL04_007435 · OH-1004

Mitochondrion0.067

Rank 2 · LXL04_007435 · OH-1004

Cytoplasm0.030

Rank 3 · LXL04_007435 · OH-1004

Nucleus0.024

Rank 4 · LXL04_007435 · OH-1004

Peroxisome0.019

Rank 5 · LXL04_007435 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00300.28His_Phos_183-161 aa

PF00300.28His_Phos_1181-288 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007435	`PF00300.28`	His_Phos_1	83	161	7.1e-35	121.2
LXL04_007435	`PF00300.28`	His_Phos_1	181	288	7.1e-35	121.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LM13`	Arabidopsis thaliana	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 1	69.767%	Swiss-Prot	strong database homology
`F4I8M8`	Arabidopsis thaliana	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2	67.315%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card