TkA03G163330 | RubberDandelionOmics

Gene overview

TkA03G163330

Reference: TK1151 Chr: Chr03 Coordinates: 41423969-41428310 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2105 bp · TkA03G163330|TK1151|cDNA

CAAGCTCCGATTTTTAAACGGTGCATAAAATTAGAAGGCAGGGAGTTTTCTTTCAATCTTCCCTCCTCCACTCTCCCTTCAAATAATATCTGCCTCTCAACGCCATACTATTTCTCTCCCCTTCTCTCTCTCTCTGTACCATTCGATTTTCGTCCATTCTTTCTCCGCCACCGTCTCTCACTTTCTCCGTCACTGTCACCGTCGTCACGCACCTCGGAGCGACCGCGCCGCCGCGCGTGCCATTAATTATGGAGATTGCT...

CDS

Download CDS FASTA

1146 bp · TkA03G163330|TK1151|CDS

ATGAAAGTTTCTCGGAAAATGTCGAAGAATTTCATGAACAGAGCAAGCTCGAAGAAACCTCAGAAAAACCTAGAAAATAAATCGGATGAAAGTTCGAAAAACAAGCCGGATCGTGGTATTGAAAGCGACGATCAATCGTCTCCAAGAGGCGTGTTTGAAGTTCCAGGTTCCGGTTCAGATTCCGACAACAGTATCAACTTAAGAAGGTGCATGAGTGCGAGCGCGAGTAGCTACAGCTTGAAATTTTGTGAGAAACCTCA...

Protein

Download Protein FASTA

381 aa · TkA03G163330|TK1151|PROTEIN

MKVSRKMSKNFMNRASSKKPQKNLENKSDESSKNKPDRGIESDDQSSPRGVFEVPGSGSDSDNSINLRRCMSASASSYSLKFCEKPQAVTTGGCDGDGDREKHSTSIPASPTAESVPWRNMVDNLKWKSFRRFSTGPLVAGYELSRKSFMKKLGRNNSSEAINNEFFMPKPSWRSFTYEELESATNGFSPENLLGKGGHAEVYKGYLPDGQIVAVKKITKKEKKDQDRVGDFLAELGIIAHINHPNAARLIGFSSDNDLH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G163330`
TK1151 ID	TkA03G163330
OH-1004 ID	LXL04_007385
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	96.800
Protein coverage (%)	TK1151 98.163 / OH-1004 70.968 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G163330

Location Chr03:41423969-41428310 (-)

Description Similar to RBK1: Receptor-like cytosolic serine/threonine-protein kinase RBK1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g10520`	Receptor-like cytosolic serine/threonine-protein kinase RBK1.	No verified direct reference in this release
`At3g05140`	Receptor-like cytosolic serine/threonine-protein kinase RBK2.	No verified direct reference in this release
`At5g57670`	Probable receptor-like serine/threonine-protein kinase At5g57670.	No verified direct reference in this release
`At2g16750`	Promotes cell proliferation in the gibberellic acid (GA) signaling pathway, acting downstream of RGA, and possibly through a negative regulation of two cyclin-dependent kinase inhibitors SIM and SMR1.	No verified direct reference in this release
`At1g68690`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007385 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009611 response to wounding Biological Process

GO:0009620 response to fungus Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0010476 gibberellin mediated signaling pathway Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0051781 positive regulation of cell division Biological Process

GO:0071369 cellular response to ethylene stimulus Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G16750

ath:AT3G05140

ath:AT3G24550

ath:AT5G10520

ath:AT5G57670

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.595

Rank 1 · TkA03G163330 · TK1151

Cytoplasm0.291

Rank 2 · TkA03G163330 · TK1151

Nucleus0.268

Rank 3 · TkA03G163330 · TK1151

Endoplasmic reticulum0.040

Rank 4 · TkA03G163330 · TK1151

Golgi apparatus0.033

Rank 5 · TkA03G163330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase191-362 aa

PF07714PK_Tyr_Ser-Thr192-366 aa

PF03109ABC1200-218 aa

PF17667Pkinase_fungal299-363 aa

PF01636APH299-337 aa

PF03109ABC1300-348 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G163330	`PF00069`	Pkinase	191	362	1.4e-33	117.2
TkA03G163330	`PF07714`	PK_Tyr_Ser-Thr	192	366	1.7e-32	113.5
TkA03G163330	`PF03109`	ABC1	200	218	0.00025	21.0
TkA03G163330	`PF17667`	Pkinase_fungal	299	363	0.0024	17.4
TkA03G163330	`PF01636`	APH	299	337	0.057	13.9
TkA03G163330	`PF03109`	ABC1	300	348	0.00025	21.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H1D6`	Arabidopsis thaliana	sp\|Q8H1D6\|RBK1_ARATH Receptor-like cytosolic serine/threonine-protein kinase RBK1	59.300%	Swiss-Prot	High
`Q8RXC8`	Arabidopsis thaliana	sp\|Q8RXC8\|RBK2_ARATH Receptor-like cytosolic serine/threonine-protein kinase RBK2	40.700%	Swiss-Prot	Medium
`Q5XF57`	Arabidopsis thaliana	sp\|Q5XF57\|Y5576_ARATH Probable receptor-like serine/threonine-protein kinase At5g57670	51.200%	Swiss-Prot	Medium
`B5X4Z9`	Arabidopsis thaliana	sp\|B5X4Z9\|STU_ARATH Protein kinase STUNTED	46.600%	Swiss-Prot	Medium
`Q9SX31`	Arabidopsis thaliana	sp\|Q9SX31\|PERK9_ARATH Proline-rich receptor-like protein kinase PERK9	41.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card