RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G151330
Reference: TK1151 Chr: Chr03 Coordinates: 38427211-38429624 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1116 bp · TkA03G151330|TK1151|cDNA

ATTTTACTTTCTCTCTCTATCTCTATCTCTCTCACTCTCTCTCTCTCTCTCACACTTCCCACAAATGTTATCTGATGGTGGTGGTTGTGGTGGTGATGATGTTAACAAGAATCTAAACACAAGTCACCATAATCTTGGTAGGGTTTCAACAAGATCTACAACACTATCATCATCTTCTTCTTCCAACACCTCTTCCAACCACTCGCCATTTTCGGTTTCTTTAACTGTTAACCAGATCAAGAGCACTCCAACCGCCACCA...

CDS

Download CDS FASTA

807 bp · TkA03G151330|TK1151|CDS

ATGTTATCTGATGGTGGTGGTTGTGGTGGTGATGATGTTAACAAGAATCTAAACACAAGTCACCATAATCTTGGTAGGGTTTCAACAAGATCTACAACACTATCATCATCTTCTTCTTCCAACACCTCTTCCAACCACTCGCCATTTTCGGTTTCTTTAACTGTTAACCAGATCAAGAGCACTCCAACCGCCACCAGAACAATGGAGGAGGTTTGGAAAGATATCAACCTTTGCTCCACCACCAACCACCCTGCTGCCGG...

Protein

Download Protein FASTA

268 aa · TkA03G151330|TK1151|PROTEIN

MLSDGGGCGGDDVNKNLNTSHHNLGRVSTRSTTLSSSSSSNTSSNHSPFSVSLTVNQIKSTPTATRTMEEVWKDINLCSTTNHPAAGTKGYRGFILQDFLAKPFSNNETPTSLSSPGYGSPSPPPPAPPTSQPSMLINLNSGPDQLNFLADDPTRNVSPLDGPFDHVLGSSNSSSGLLGQSIGGMRMLPATDRVGGGERRHKRMIKNRESAARSRARKQAYMNELENEVERLKEENAKLKRQQQELQVAPAAQMTKKGGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G151330
TK1151 IDTkA03G151330
OH-1004 IDLXL04_007308
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 74.238
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G151330
LocationChr03:38427211-38429624 (+)
DescriptionSimilar to FD: Protein FD
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g35900 Transcription factor required for the transition to flowering promoted by FT. No verified direct reference in this release
At2g17770 Transcription factor required for the transition to flowering promoted by FT. No verified direct reference in this release
At3g56850 Binds to the embryo specification element and the ABA-responsive element (ABRE) of the Dc3 gene promoter. No verified direct reference in this release
At3g44460 Could participate in abscisic acid-regulated gene expression during seed development. No verified direct reference in this release
At1g45249 Involved in ABA and stress responses and acts as a positive component of glucose signal transduction.
Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions.2000 · DOI: 10.1073/pnas.190309197
AREB1 is a transcription activator of novel ABRE-dependent ABA signaling that enhances drought stress tolerance in Arabidopsis.2005 · DOI: 10.1105/tpc.105.035659
Transcriptional regulation of ABI3- and ABA-responsive genes including RD29B and RD29A in seeds, germinating embryos, and seedlings of Arabidopsis.2006 · DOI: 10.1007/s11103-005-2418-5

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_007308 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009648 photoperiodism Biological Process
GO:0009651 response to salt stress Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009909 regulation of flower development Biological Process
GO:0009911 positive regulation of flower development Biological Process
GO:0010255 glucose mediated signaling pathway Biological Process
GO:0045893 positive regulation of DNA-templated transcription Biological Process
GO:2000028 regulation of photoperiodism, flowering Biological Process
KEGG gene cross-reference
ath:AT1G45249
ath:AT2G17770
ath:AT3G56850
ath:AT4G35900
dosa:Os02g0766700
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.972
Rank 1 · TkA03G151330 · TK1151
Cytoplasm0.096
Rank 2 · TkA03G151330 · TK1151
Cell membrane0.027
Rank 3 · TkA03G151330 · TK1151
Endoplasmic reticulum0.016
Rank 4 · TkA03G151330 · TK1151
Plastid0.011
Rank 5 · TkA03G151330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08286Spc2414-40 aa
PF04637Herpes_pp8526-64 aa
PF24590DUF761531-73 aa
PF25966Myo5a33-61 aa
PF28362NcaA_C35-44 aa
PF14197Cep57_CLD_2192-240 aa
PF07716bZIP_2198-247 aa
PF28121VPA1267198-247 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G151330PF08286Spc2414400.4611.5
TkA03G151330PF04637Herpes_pp8526642.76.9
TkA03G151330PF24590DUF761531730.4111.9
TkA03G151330PF25966Myo5a33610.3211.8
TkA03G151330PF28362NcaA_C35449.36.9
TkA03G151330PF14197Cep57_CLD_21922400.007417.1
TkA03G151330PF07716bZIP_21982472.1e-1144.4
TkA03G151330PF28121VPA12671982470.4611.4
TkA03G151330PF00170bZIP_11992472.6e-1350.6
TkA03G151330PF03131bZIP_Maf1992570.0117.0
TkA03G151330PF10224DUF22051992470.5811.0
TkA03G151330PF13863DUF42001992470.9910.5
TkA03G151330PF11559ADIP2002560.1512.8
TkA03G151330PF06785UPF02422012470.212.4
TkA03G151330PF25966Myo5a2012580.3211.8
TkA03G151330PF24590DUF76152092410.4111.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q84JK2Arabidopsis thalianasp|Q84JK2|FD_ARATH Protein FD42.200%Swiss-ProtMedium
Q7PCC6Arabidopsis thalianasp|Q7PCC6|FDP_ARATH bZIP transcription factor 2738.000%Swiss-ProtMedium
Q9LES3Arabidopsis thalianasp|Q9LES3|AI5L2_ARATH ABSCISIC ACID-INSENSITIVE 5-like protein 235.100%Swiss-ProtMedium
Q8RYD6Arabidopsis thalianasp|Q8RYD6|AI5L1_ARATH ABSCISIC ACID-INSENSITIVE 5-like protein 134.000%Swiss-ProtMedium
Q9M7Q4Arabidopsis thalianasp|Q9M7Q4|AI5L5_ARATH ABSCISIC ACID-INSENSITIVE 5-like protein 544.000%Swiss-ProtLow

JBrowse

View in Genome Browser