RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G127040
Reference: TK1151 Chr: Chr03 Coordinates: 32568092-32573551 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2476 bp · TkA03G127040|TK1151|cDNA

AAGAAAATAAAGTAGCGTGTTAGTTTTTGGTGATTCCTTTTGAAACTGGTGGCTGCACCGGTGGCCTCGCGTTACAAGTTTAAGCCCCAAAATTGATGCATCGCGTCCATTGTCTCCTCCAGCCATCAATTACTTGCCGTGCACCCGCCCACCTCCTCTTCAACTACTCTTCATTAGCCTGCCCGCAGCACTCCTATTTCTCTCATTCCCCCTTCCGTTCCCTCTCCCCTTTCTATCACCGTTCTTAAAGCCAATAGTAG...

CDS

Download CDS FASTA

1890 bp · TkA03G127040|TK1151|CDS

ATGTGGCGGTGCGTGTCACGTGGCCTTCGCATTCCTTCCCGGAGATCCACCTCCGGCGATTTTCTATCGCGCAAATTCTTCTCTTCTGAATCGACTGTCGGAAAATCATCATATACGATAGTTGATCATACATACGACGCCGTTGTGGTTGGAGCAGGAGGTGCTGGACTTCGAGCTGCCATAGGGCTATCTGAGCATGGCTTCAATACTGCTTGCATCACCAAGCTGTTCCCAACTCGCTCTCACACCGTTGCCGCTCA...

Protein

Download Protein FASTA

629 aa · TkA03G127040|TK1151|PROTEIN

MWRCVSRGLRIPSRRSTSGDFLSRKFFSSESTVGKSSYTIVDHTYDAVVVGAGGAGLRAAIGLSEHGFNTACITKLFPTRSHTVAAQGGINAALGNMTEDDWRWHMYDTVKGSDWLGDQDAIQYMCREAPKAVIELENYGLPFSRTEEGKIYQRAFGGQSLDFGKGGQAYRCACAADRTGHALLHTLYGQAMKHNTQFFVEYFALDLIMGSDGSCQGVIALNMEDGTLHRFRSSSTILATGGYGRAYFSATSAHTCTGDG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G127040
TK1151 IDTkA03G127040
OH-1004 IDLXL04_007142
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G127040
LocationChr03:32568092-32573551 (+)
DescriptionSimilar to SDH1-1: Succinate dehydrogenase [ubiquinone] flavoprotein subunit 1, mitochondrial
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g66760 Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q). No verified direct reference in this release
At2g18450 Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q). No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os07g0134800 Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q). No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_007142 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006099 tricarboxylic acid cycle Biological Process
GO:0006121 mitochondrial electron transport, succinate to ubiquinone Biological Process
GO:0006909 phagocytosis Biological Process
GO:0007005 mitochondrion organization Biological Process
GO:0046956 positive phototaxis Biological Process
GO:0050829 defense response to Gram-negative bacterium Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0005743 mitochondrial inner membrane Cellular Component
GO:0009505 plant-type cell wall Cellular Component
GO:0009536 plastid Cellular Component
GO:0045273 respiratory chain complex II (succinate dehydrogenase) Cellular Component
GO:0045335 phagocytic vesicle Cellular Component
KEGG gene cross-reference
ath:AT2G18450
ath:AT5G66760
ddi:DDB_G0280535
dosa:Os07g0134800
spo:2541690
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.940
Rank 1 · TkA03G127040 · TK1151
Cytoplasm0.069
Rank 2 · TkA03G127040 · TK1151
Nucleus0.053
Rank 3 · TkA03G127040 · TK1151
Cell membrane0.019
Rank 4 · TkA03G127040 · TK1151
Plastid0.009
Rank 5 · TkA03G127040 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07992Pyr_redox_245-79 aa
PF01946Thi445-74 aa
PF01494FAD_binding_345-81 aa
PF00890FAD_binding_246-442 aa
PF01266DAO46-152 aa
PF01134GIDA46-76 aa
PF03486HI0933_like46-91 aa
PF05834Lycopene_cycl46-185 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G127040PF07992Pyr_redox_245790.0004720.4
TkA03G127040PF01946Thi445740.001218.9
TkA03G127040PF01494FAD_binding_345810.005616.7
TkA03G127040PF00890FAD_binding_2464425.1e-125418.6
TkA03G127040PF01266DAO461527.8e-0523.1
TkA03G127040PF01134GIDA46760.003717.1
TkA03G127040PF03486HI0933_like46910.01415.6
TkA03G127040PF05834Lycopene_cycl461850.2711.0
TkA03G127040PF01134GIDA2082550.003717.1
TkA03G127040PF03486HI0933_like2272970.01415.6
TkA03G127040PF01946Thi44144390.001218.9
TkA03G127040PF02910Succ_DH_flav_C4976291.5e-47161.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O82663Arabidopsis thalianasp|O82663|SDHA1_ARATH Succinate dehydrogenase [ubiquinone] flavoprotein subunit 1, mitochondrial91.300%Swiss-ProtHigh
Q9ZPX5Arabidopsis thalianasp|Q9ZPX5|SDHA2_ARATH Succinate dehydrogenase [ubiquinone] flavoprotein subunit 2, mitochondrial87.500%Swiss-ProtHigh
Q6ZDY8Oryza sativa subsp. japonicasp|Q6ZDY8|SDHA_ORYSJ Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial90.800%Swiss-ProtHigh

JBrowse

View in Genome Browser