LXL04_007142 | RubberDandelionOmics

Gene overview

LXL04_007142

Reference: OH-1004 Chr: Chr02 Coordinates: 37276718-37281308 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1890 bp · LXL04_007142|LXL04_007142|OH1004|cDNA

ATGTGGCGGTGCGTGTCACGTGGCCTTCGCATTCCTTCCCGGAGATCCACCTCCGGCGATTTTCTATCGCGCAAATTCTTCTCTTCTGAATCGACTGTCGGAAAATCATCATATACGATAGTTGATCATACATACGACGCCGTTGTGGTTGGAGCAGGAGGTGCTGGACTTCGAGCTGCCATAGGGCTATCTGAGCATGGCTTCAATACTGCTTGCATCACCAAGCTGTTCCCAACTCGCTCTCACACCGTTGCCGCTCA...

CDS

Download CDS FASTA

1890 bp · LXL04_007142|LXL04_007142|OH1004|CDS

ATGTGGCGGTGCGTGTCACGTGGCCTTCGCATTCCTTCCCGGAGATCCACCTCCGGCGATTTTCTATCGCGCAAATTCTTCTCTTCTGAATCGACTGTCGGAAAATCATCATATACGATAGTTGATCATACATACGACGCCGTTGTGGTTGGAGCAGGAGGTGCTGGACTTCGAGCTGCCATAGGGCTATCTGAGCATGGCTTCAATACTGCTTGCATCACCAAGCTGTTCCCAACTCGCTCTCACACCGTTGCCGCTCA...

Protein

Download Protein FASTA

629 aa · LXL04_007142|LXL04_007142|OH1004|PROTEIN

MWRCVSRGLRIPSRRSTSGDFLSRKFFSSESTVGKSSYTIVDHTYDAVVVGAGGAGLRAAIGLSEHGFNTACITKLFPTRSHTVAAQGGINAALGNMTEDDWRWHMYDTVKGSDWLGDQDAIQYMCREAPKAVIELENYGLPFSRTEEGKIYQRAFGGQSLDFGKGGQAYRCACAADRTGHALLHTLYGQAMKHNTQFFVEYFALDLIMGSDGSCQGVIALNMEDGTLHRFRSSSTILATGGYGRAYFSATSAHTCTGDG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007142`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007142

Location Chr02:37276718-37281308 (+)

Description Similar to SDH1-1: Succinate dehydrogenase [ubiquinone] flavoprotein subunit 1, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g66760`	Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q).	No verified direct reference in this release
`At2g18450`	Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0134800`	Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007142 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006121 mitochondrial electron transport, succinate to ubiquinone Biological Process

GO:0006909 phagocytosis Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0046956 positive phototaxis Biological Process

GO:0050829 defense response to Gram-negative bacterium Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009536 plastid Cellular Component

GO:0045273 respiratory chain complex II (succinate dehydrogenase) Cellular Component

GO:0045335 phagocytic vesicle Cellular Component

KEGG gene cross-reference

ath:AT2G18450

ath:AT5G66760

ddi:DDB_G0280535

dosa:Os07g0134800

spo:2541690

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.940

Rank 1 · LXL04_007142 · OH-1004

Cytoplasm0.069

Rank 2 · LXL04_007142 · OH-1004

Nucleus0.053

Rank 3 · LXL04_007142 · OH-1004

Cell membrane0.019

Rank 4 · LXL04_007142 · OH-1004

Plastid0.009

Rank 5 · LXL04_007142 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00890.31FAD_binding_246-442 aa

PF02910.26Succ_DH_flav_C497-629 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007142	`PF00890.31`	FAD_binding_2	46	442	5.1e-125	418.6
LXL04_007142	`PF02910.26`	Succ_DH_flav_C	497	629	1.5e-47	161.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82663`	Arabidopsis thaliana	Succinate dehydrogenase [ubiquinone] flavoprotein subunit 1, mitochondrial	91.339%	Swiss-Prot	strong database homology
`Q9ZPX5`	Arabidopsis thaliana	Succinate dehydrogenase [ubiquinone] flavoprotein subunit 2, mitochondrial	87.579%	Swiss-Prot	strong database homology
`Q6ZDY8`	Oryza sativa subsp. japonica	Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial	90.794%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card