Gene Card
Gene overview
cDNA / CDS / Protein Sequences
804 bp · TkA03G125480|TK1151|cDNA
ATGCAAGGTCTCCAGTGGCCTGGACTGTTCGACATCCTCGCCTCCCGACCTCGCAAAATCAAACCCCTTAGAATTACCGGCGTCGGATCTTCCATCGAACTTCTCGAAGCCACCGGCCGCCGTCTCCATGACTTCGCAAACTCCCTGGGCCTCCCATTCGAATTCACCCCCCTCGAAGGAAAAATCGGAAACATCACTTCTGAACTCACAACCCAACTCGGCGTCATACCTGGTGAAACGATGGTCGTTCACTGGATGCA...
804 bp · TkA03G125480|TK1151|CDS
ATGCAAGGTCTCCAGTGGCCTGGACTGTTCGACATCCTCGCCTCCCGACCTCGCAAAATCAAACCCCTTAGAATTACCGGCGTCGGATCTTCCATCGAACTTCTCGAAGCCACCGGCCGCCGTCTCCATGACTTCGCAAACTCCCTGGGCCTCCCATTCGAATTCACCCCCCTCGAAGGAAAAATCGGAAACATCACTTCTGAACTCACAACCCAACTCGGCGTCATACCTGGTGAAACGATGGTCGTTCACTGGATGCA...
Protein
Download Protein FASTA267 aa · TkA03G125480|TK1151|PROTEIN
MQGLQWPGLFDILASRPRKIKPLRITGVGSSIELLEATGRRLHDFANSLGLPFEFTPLEGKIGNITSELTTQLGVIPGETMVVHWMHHCLYGVTGSDFCTLRLLTLLKPKLITIVEQDLSHGGSFLGRFVEALHYYSALFDALGDRLESENVERHTVEQQLFGCEIKNIVAVGGPKRTGKVKMERWGEELGRVGFKPVSLAGNPAAQASLLLGMFRSSFPSSSLYFDLSYTSRFRTGHLDGCSVFNRTPISAILKHLEFY...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G125480 |
|---|---|
| TK1151 ID | TkA03G125480 |
| OH-1004 ID | LXL04_011485 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 95.800 |
| Protein coverage (%) | TK1151 80.524 / OH-1004 47.461Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G125480 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:32207298-32208101 (-) | |||||||||
| Description | Similar to SCL23: Scarecrow-like protein 23 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0008356 asymmetric cell division Biological Process GO:0009610 response to symbiotic fungus Biological Process GO:0009630 gravitropism Biological Process GO:0009956 radial pattern formation Biological Process GO:0045454 cell redox homeostasis Biological Process GO:0048364 root development Biological Process GO:0048366 leaf development Biological Process GO:0051457 maintenance of protein location in nucleus Biological Process GO:0090610 bundle sheath cell fate specification Biological Process GO:0005634 nucleus Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT3G54220 ath:AT5G41920 dosa:Os11g0124300 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF03514GRAS1-217 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G125480 | PF03514 | GRAS | 1 | 217 | 2.4e-57 | 195.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.