TkA03G125040 | RubberDandelionOmics

Gene overview

TkA03G125040

Reference: TK1151 Chr: Chr03 Coordinates: 32100690-32108032 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1333 bp · TkA03G125040|TK1151|cDNA

TTCACTAGGGCCCTTCTAGATTATCTATAAATACTTTATGTATTCTGCTTTCTTCTTCTTTAACTTTTGAGCATCACGCATACAATAATGAACTTCCAAAGGCAAAATTTGTTTGCATTCTTGCTTTTAATCCTCATATCCACCAAAGTTTTGGCCGAATGCACTTGTGAACCAGAAGAAGACGAGGGCAAAAAGAGTGAAGCTCTCAAGTACAAACTCATAGCACTTGCTTCCATCCTCATATTTGGTGGCATCGGCGT...

CDS

Download CDS FASTA

1062 bp · TkA03G125040|TK1151|CDS

ATGAACTTCCAAAGGCAAAATTTGTTTGCATTCTTGCTTTTAATCCTCATATCCACCAAAGTTTTGGCCGAATGCACTTGTGAACCAGAAGAAGACGAGGGCAAAAAGAGTGAAGCTCTCAAGTACAAACTCATAGCACTTGCTTCCATCCTCATATTTGGTGGCATCGGCGTTTGCATACCCTTCATCGGAAAACTCATTCCGGCATTAAGCCCTGAAAAAGACGGTTTCTTTGTAATCAAGGCATTCGCTGCTGGAGT...

Protein

Download Protein FASTA

353 aa · TkA03G125040|TK1151|PROTEIN

MNFQRQNLFAFLLLILISTKVLAECTCEPEEDEGKKSEALKYKLIALASILIFGGIGVCIPFIGKLIPALSPEKDGFFVIKAFAAGVILATGFIHILPDAFESLTNPCLKEHPWGDFPFTGFVAMVATILTLLFETSSAAYQLRSHSEAQGKTAGSNGDEEGSSVRGSQVAAHTHASHGHAHGSMSHVEGLSQVDRYRIVSKVLELGIIVHSVIIGLSMGASQSPKTIKPLVIALTFHQFFEGIGLGGCIFQAEFKSLAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G125040`
TK1151 ID	TkA03G125040
OH-1004 ID	LXL04_007127
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 84.419 / OH-1004 17.812 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G125040

Location Chr03:32100690-32108032 (+)

Description Similar to RE2: Retrovirus-related Pol polyprotein from transposon RE2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g32270`	Mediates zinc uptake from the rhizosphere.	No verified direct reference in this release
`At1g05300`	Probably mediates zinc uptake from the rhizosphere.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0472400`	Zinc transporter that may be involved in zinc uptake from the rhizosphere.	No verified direct reference in this release
`Os07g0232800`	Zinc transporter that may mediate zinc uptake from the rhizosphere and may be responsible for the translocation of zinc within the plant.	Zinc deficiency-inducible OsZIP8 encodes a plasma membrane-localized zinc transporter in rice.2010 · DOI: 10.1007/s10059-010-0069-0
`Os05g0472700`	Zinc transporter that mediates zinc uptake from the rhizosphere and may be responsible for the translocation of zinc within the plant.	OsZIP5 is a plasma membrane zinc transporter in rice.2010 · DOI: 10.1007/s11103-010-9637-0

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007127 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006508 proteolysis Biological Process

GO:0015074 DNA integration Biological Process

GO:0003676 nucleic acid binding Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

GO:0004519 endonuclease activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.751

Rank 1 · TkA03G125040 · TK1151

Endoplasmic reticulum0.099

Rank 2 · TkA03G125040 · TK1151

Lysosome / Vacuole0.088

Rank 3 · TkA03G125040 · TK1151

Cytoplasm0.069

Rank 4 · TkA03G125040 · TK1151

Golgi apparatus0.037

Rank 5 · TkA03G125040 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13670PepSY_28-42 aa

PF02535Zip41-350 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G125040	`PF13670`	PepSY_2	8	42	0.21	12.3
TkA03G125040	`PF02535`	Zip	41	350	2.2e-78	264.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SLG3`	Arabidopsis thaliana	sp\|Q9SLG3\|ZIP3_ARATH Zinc transporter 3	54.200%	Swiss-Prot	High
`O23039`	Arabidopsis thaliana	sp\|O23039\|ZIP5_ARATH Zinc transporter 5	52.600%	Swiss-Prot	High
`Q0DHE3`	Oryza sativa subsp. japonica	sp\|Q0DHE3\|ZIP9_ORYSJ Zinc transporter 9	48.400%	Swiss-Prot	Medium
`A3BI11`	Oryza sativa subsp. japonica	sp\|A3BI11\|ZIP8_ORYSJ Zinc transporter 8	50.300%	Swiss-Prot	High
`Q6L8G0`	Oryza sativa subsp. japonica	sp\|Q6L8G0\|ZIP5_ORYSJ Zinc transporter 5	49.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card