LXL04_007127 | RubberDandelionOmics

Gene overview

LXL04_007127

Reference: OH-1004 Chr: Chr02 Coordinates: 36854288-36867736 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5022 bp · LXL04_007127|LXL04_007127|OH1004|cDNA

ATGAACTTCCAAAGGCAAAATTTGTTTGCATTCTTGCTTTTAATCCTCATATCCACCAAAGTTTTGGCCGAATGCACTTGTGAACCAGAAGAAGACGAGGGCAAAAAGAGTGAAGCTCTCAAGTACAAACTCATAGCACTTGCTTCCATCCTCATATTTGGTGGCATCGGCGTTTGCATACCCTTCATCGGAAAACTCATTCCGGCATTAAGCCCTGAAAAAGACGGTTTCTTTGTAATCAAGGCATTCGCTGCTGGAGT...

CDS

Download CDS FASTA

5022 bp · LXL04_007127|LXL04_007127|OH1004|CDS

ATGAACTTCCAAAGGCAAAATTTGTTTGCATTCTTGCTTTTAATCCTCATATCCACCAAAGTTTTGGCCGAATGCACTTGTGAACCAGAAGAAGACGAGGGCAAAAAGAGTGAAGCTCTCAAGTACAAACTCATAGCACTTGCTTCCATCCTCATATTTGGTGGCATCGGCGTTTGCATACCCTTCATCGGAAAACTCATTCCGGCATTAAGCCCTGAAAAAGACGGTTTCTTTGTAATCAAGGCATTCGCTGCTGGAGT...

Protein

Download Protein FASTA

1673 aa · LXL04_007127|LXL04_007127|OH1004|PROTEIN

MNFQRQNLFAFLLLILISTKVLAECTCEPEEDEGKKSEALKYKLIALASILIFGGIGVCIPFIGKLIPALSPEKDGFFVIKAFAAGVILATGFIHILPDAFESLTNPCLKEHPWGDFPFTGFVAMVATILTLLFETSSAAYQLRSHSEAQGKTAGSNGDEEGSSVRGSQVAAHTHASHGHAHGSMSHVEGLSQVDRYRIVSKVLELGIIVHSVIIGLSMGASQSPKTIKPLVIALTFHQFFEGIGLGGCIFQAEFKSLAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007127`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007127

Location Chr02:36854288-36867736 (+)

Description Similar to RE2: Retrovirus-related Pol polyprotein from transposon RE2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02960`	Retrovirus-related Pol polyprotein from transposon RE2.	No verified direct reference in this release
`At1g05300`	Probably mediates zinc uptake from the rhizosphere.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0472700`	Zinc transporter that mediates zinc uptake from the rhizosphere and may be responsible for the translocation of zinc within the plant.	OsZIP5 is a plasma membrane zinc transporter in rice.2010 · DOI: 10.1007/s11103-010-9637-0

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007127 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006508 proteolysis Biological Process

GO:0015074 DNA integration Biological Process

GO:0003676 nucleic acid binding Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

GO:0004519 endonuclease activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.507

Rank 1 · LXL04_007127 · OH-1004

Nucleus0.189

Rank 2 · LXL04_007127 · OH-1004

Endoplasmic reticulum0.156

Rank 3 · LXL04_007127 · OH-1004

Lysosome / Vacuole0.094

Rank 4 · LXL04_007127 · OH-1004

Cell membrane0.091

Rank 5 · LXL04_007127 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02535.29Zip41-298 aa

PF02535.29Zip331-545 aa

PF14223.15Retrotran_gag_2546-677 aa

PF25597.2SH3_retrovirus982-1042 aa

PF07727.20RVT_21214-1414 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007127	`PF02535.29`	Zip	41	298	2.3e-102	343.2
LXL04_007127	`PF02535.29`	Zip	331	545	2.3e-102	343.2
LXL04_007127	`PF14223.15`	Retrotran_gag_2	546	677	1.3e-15	58.3
LXL04_007127	`PF25597.2`	SH3_retrovirus	982	1042	2.2e-22	79.3
LXL04_007127	`PF07727.20`	RVT_2	1214	1414	6.1e-59	200.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZT94`	Arabidopsis thaliana	Retrovirus-related Pol polyprotein from transposon RE2	46.520%	Swiss-Prot	weak database homology
`O23039`	Arabidopsis thaliana	Zinc transporter 5	51.971%	Swiss-Prot	weak database homology
`Q6L8G0`	Oryza sativa subsp. japonica	Zinc transporter 5	48.822%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card