RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G066760
Reference: TK1151 Chr: Chr03 Coordinates: 17188625-17194248 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

4656 bp · TkA03G066760|TK1151|cDNA

TTTTAATACAAGTGCATAACATGTCTCTTATTTTTATAGCCTCTCAGTTCCAATTGGAGGACCAGCCAGTCAAGTGGGAAGAAGACGCGGTGTTGTAACCCTGACCCACCGCCCACGCACCCATTCCGGATAATCGATAACATCGGGTTGCGGTTAGAACTACAAGTTAAAAGCACACTCCGTTAGTGGAGTTGTGCGTGTGTTTCTTGTAACCTAAAAGAAAAGGTCAACTCCCTCTCACTCATTTTCAAAATATCCAA...

CDS

Download CDS FASTA

1734 bp · TkA03G066760|TK1151|CDS

ATGGAGAGCTATTTGAATGATAATTTCGAGGTCAAGCCGAAGAACTCATCGGAGGAAGCGCTGCAGAGATGGAGGAAGTTGTGTTGGGTGGTGAAGAATCGGAAACGACGTTTCCGTTTCACTGCTAATCTCTCCAAGCGTTTCGAAGCTCGTGCTATTCAACGATCCAATCTGGAGAGTCTAAGAACCTTGATGCTGGTTTCACATGCAGCCATTCAATTTCTTAACGGTATCACTTACAGTGTACCTGATGAAGTGAA...

Protein

Download Protein FASTA

577 aa · TkA03G066760|TK1151|PROTEIN

MESYLNDNFEVKPKNSSEEALQRWRKLCWVVKNRKRRFRFTANLSKRFEARAIQRSNLESLRTLMLVSHAAIQFLNGITYSVPDEVKAAGFQIGPDELGSIVEGRSLEKLKGHDGVEGIVKKISTSTSNGISTSEDLLTRRKDIYGINQFTESPSKGFLVYIWEALQDTTLMILGLCASVSLIVGIIMEGWPKGAHDGLGIVASIMLVVFVTATSDYRQSLQFKDLDKEKKKITIQVTRNDCRQKISIYDLLVGDIVHLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G066760
TK1151 IDTkA03G066760
OH-1004 IDLXL04_007935
Relationship / confidenceSequence Supported Annotation Or Model Conflict / Review
Protein identity (%)97.300
Protein coverage (%)TK1151 92.894 / OH-1004 53.554
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G066760
LocationChr03:17188625-17194248 (+)
DescriptionSimilar to ACA1: Calcium-transporting ATPase 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g27770 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell or into organelles. No verified direct reference in this release
At4g37640 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the endoplasmic reticulum. No verified direct reference in this release
At2g22950 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell or into organelles. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os12g0586600 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell, into the endoplasmic reticulum, or into organelles. No verified direct reference in this release
Os03g0616400 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell, into the endoplasmic reticulum, or into organelles. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_007935 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009555 pollen development Biological Process
GO:0070588 calcium ion transmembrane transport Biological Process
GO:0005634 nucleus Cellular Component
GO:0005783 endoplasmic reticulum Cellular Component
GO:0005789 endoplasmic reticulum membrane Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0009706 chloroplast inner membrane Cellular Component
GO:0016020 membrane Cellular Component
GO:0005262 calcium channel activity Molecular Function
GO:0005388 P-type calcium transporter activity Molecular Function
GO:0005516 calmodulin binding Molecular Function
KEGG gene cross-reference
ath:AT1G27770
ath:AT2G22950
ath:AT4G37640
dosa:Os03g0616400
dosa:Os12g0586600
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.575
Rank 1 · TkA03G066760 · TK1151
Endoplasmic reticulum0.184
Rank 2 · TkA03G066760 · TK1151
Lysosome / Vacuole0.127
Rank 3 · TkA03G066760 · TK1151
Cytoplasm0.097
Rank 4 · TkA03G066760 · TK1151
Golgi apparatus0.077
Rank 5 · TkA03G066760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12515CaATP_NAI5-49 aa
PF00690Cation_ATPase_N114-181 aa
PF13273DUF4064169-206 aa
PF25103DUF7811170-186 aa
PF00122E1-E2_ATPase233-330 aa
PF13273DUF4064349-405 aa
PF25103DUF7811478-515 aa
PF13246Cation_ATPase506-534 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G066760PF12515CaATP_NAI5499.2e-2277.0
TkA03G066760PF00690Cation_ATPase_N1141811.3e-0835.0
TkA03G066760PF13273DUF40641692061.310.0
TkA03G066760PF25103DUF78111701860.1812.2
TkA03G066760PF00122E1-E2_ATPase2333301.7e-2176.6
TkA03G066760PF13273DUF40643494051.310.0
TkA03G066760PF25103DUF78114785150.1812.2
TkA03G066760PF13246Cation_ATPase5065340.1712.4
TkA03G066760PF00690Cation_ATPase_N5525631.3e-0835.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q37145Arabidopsis thalianasp|Q37145|ACA1_ARATH Calcium-transporting ATPase 175.700%Swiss-ProtHigh
O81108Arabidopsis thalianasp|O81108|ACA2_ARATH Calcium-transporting ATPase 2, plasma membrane-type72.100%Swiss-ProtHigh
O64806Arabidopsis thalianasp|O64806|ACA7_ARATH Putative calcium-transporting ATPase 7, plasma membrane-type72.400%Swiss-ProtHigh
Q2QMX9Oryza sativa subsp. japonicasp|Q2QMX9|ACA10_ORYSJ Calcium-transporting ATPase 10, plasma membrane-type73.700%Swiss-ProtHigh
Q6ATV4Oryza sativa subsp. japonicasp|Q6ATV4|ACA3_ORYSJ Calcium-transporting ATPase 3, plasma membrane-type64.500%Swiss-ProtHigh

JBrowse

View in Genome Browser