LXL04_007935 | RubberDandelionOmics

Gene overview

LXL04_007935

Reference: OH-1004 Chr: Chr02 Coordinates: 75973818-75977633 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3084 bp · LXL04_007935|LXL04_007935|OH1004|cDNA

ATGGAGAGCTATTTGAATGATAATTTCGAGGTCAAGCCGAAGAACTCATCGGAGGAAGCGCTGCAGAGATGGAGGAAGTTGTGTTGGGTGGTGAAGAATCGGAAACGACGTTTCCGTTTCACTGCTAATCTCTCCAAGCGTTTCGAAGCTCGTGCTATTCAACGATCCAATCTGGTCAATCCTCTTTCTCTTTTGCACTGTTTCATTTTCCGTGACGAGAGTCTAAGAACCTTGATGCTGGTTTCACATGCAGCCATTCA...

CDS

Download CDS FASTA

3084 bp · LXL04_007935|LXL04_007935|OH1004|CDS

ATGGAGAGCTATTTGAATGATAATTTCGAGGTCAAGCCGAAGAACTCATCGGAGGAAGCGCTGCAGAGATGGAGGAAGTTGTGTTGGGTGGTGAAGAATCGGAAACGACGTTTCCGTTTCACTGCTAATCTCTCCAAGCGTTTCGAAGCTCGTGCTATTCAACGATCCAATCTGGTCAATCCTCTTTCTCTTTTGCACTGTTTCATTTTCCGTGACGAGAGTCTAAGAACCTTGATGCTGGTTTCACATGCAGCCATTCA...

Protein

Download Protein FASTA

1027 aa · LXL04_007935|LXL04_007935|OH1004|PROTEIN

MESYLNDNFEVKPKNSSEEALQRWRKLCWVVKNRKRRFRFTANLSKRFEARAIQRSNLVNPLSLLHCFIFRDESLRTLMLVSHAAIQFLNGITYSVPDEVKAAGFQIGPDELGSIVEGRSLEKLKGHDGVEGIVKKISTSTSNGISTSEDLLTRRKDIYGINQFTESPSKGFLVYIWEALQDTTLMILGLCASVSLIVGIIMEGWPKGAHDGLGIVASIMLVVFVTATSDYRQSLQFKDLDKEKKKITIQVTRNDCRQKI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007935`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007935

Location Chr02:75973818-75977633 (-)

Description Similar to ACA1: Calcium-transporting ATPase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g27770`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell or into organelles.	No verified direct reference in this release
`At4g37640`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the endoplasmic reticulum.	No verified direct reference in this release
`At2g22950`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell or into organelles.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0586600`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell, into the endoplasmic reticulum, or into organelles.	No verified direct reference in this release
`Os03g0616400`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell, into the endoplasmic reticulum, or into organelles.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007935 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009555 pollen development Biological Process

GO:0070588 calcium ion transmembrane transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0005262 calcium channel activity Molecular Function

GO:0005388 P-type calcium transporter activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

KEGG gene cross-reference

ath:AT1G27770

ath:AT2G22950

ath:AT4G37640

dosa:Os03g0616400

dosa:Os12g0586600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.462

Rank 1 · LXL04_007935 · OH-1004

Endoplasmic reticulum0.204

Rank 2 · LXL04_007935 · OH-1004

Lysosome / Vacuole0.170

Rank 3 · LXL04_007935 · OH-1004

Golgi apparatus0.110

Rank 4 · LXL04_007935 · OH-1004

Cytoplasm0.109

Rank 5 · LXL04_007935 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12515.14CaATP_NAI5-49 aa

PF00690.32Cation_ATPase_N128-195 aa

PF00122.26E1-E2_ATPase247-344 aa

PF13246.13Cation_ATPase521-669 aa

PF00702.33Hydrolase638-776 aa

PF00689.27Cation_ATPase_C847-1022 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007935	`PF12515.14`	CaATP_NAI	5	49	1.7e-21	76.1
LXL04_007935	`PF00690.32`	Cation_ATPase_N	128	195	8.2e-08	32.5
LXL04_007935	`PF00122.26`	E1-E2_ATPase	247	344	2.6e-21	76.0
LXL04_007935	`PF13246.13`	Cation_ATPase	521	669	1e-34	120.7
LXL04_007935	`PF00702.33`	Hydrolase	638	776	7.7e-15	56.5
LXL04_007935	`PF00689.27`	Cation_ATPase_C	847	1022	7e-41	140.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q37145`	Arabidopsis thaliana	Calcium-transporting ATPase 1	75.942%	Swiss-Prot	strong database homology
`O81108`	Arabidopsis thaliana	Calcium-transporting ATPase 2, plasma membrane-type	73.761%	Swiss-Prot	strong database homology
`O64806`	Arabidopsis thaliana	Putative calcium-transporting ATPase 7, plasma membrane-type	73.883%	Swiss-Prot	strong database homology
`Q2QMX9`	Oryza sativa subsp. japonica	Calcium-transporting ATPase 10, plasma membrane-type	74.081%	Swiss-Prot	strong database homology
`Q6ATV4`	Oryza sativa subsp. japonica	Calcium-transporting ATPase 3, plasma membrane-type	68.991%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card