TkA03G060060 | RubberDandelionOmics

Gene overview

TkA03G060060

Reference: TK1151 Chr: Chr03 Coordinates: 15441449-15443241 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1605 bp · TkA03G060060|TK1151|cDNA

ATCACCTTTTCTCGTACATCAAAAGGTACAACTCACAAAGGACGTGTTACAACTATAAACTTTGAAGAATACCTTCGTCTCCACTCCAAAACCCAAATTCCCAAAATCAATCCACCATATAATCCTCTCCCTGATTCTTTCCCTTCAACTCAGTTCACATTTTCAAGCTCCGAAAACTTCACAATGTTGAAAATGGCGATCCTTTTAGCTCCTCTTTTCTTCCTATGTTCTTCTGTTTTAGGTCAAGAACCTTTGCAGAT...

CDS

Download CDS FASTA

1362 bp · TkA03G060060|TK1151|CDS

ATCACCTTTTCTCGTACATCAAAAGGTACAACTCACAAAGGACGTGTTACAACTATAAACTTTGAAGAATACCTTCGTCTCCACTCCAAAACCCAAATTCCCAAAATCAATCCACCATATAATCCTCTCCCTGATTCTTTCCCTTCAACTCAGTTCACATTTTCAAGCTCCGAAAACTTCACAATGTTGAAAATGGCGATCCTTTTAGCTCCTCTTTTCTTCCTATGTTCTTCTGTTTTAGGTCAAGAACCTTTGCAGAT...

Protein

Download Protein FASTA

453 aa · TkA03G060060|TK1151|PROTEIN

ITFSRTSKGTTHKGRVTTINFEEYLRLHSKTQIPKINPPYNPLPDSFPSTQFTFSSSENFTMLKMAILLAPLFFLCSSVLGQEPLQILTLNRDYSSSVAPLQTVGISLKEEKLNDVSNSVLMAEKWLRTHVLSRYPSSSIKSIVVANDILCNDKIRNREEIIRLTLDAMKNIYYSLTRWGLQKEIKVSVSLLPNCLHQLDLQNVFSFLEEINSTYTINTPQFSDKNVRLLTSELKSLNDLGVFQSQTVNVIFPVSKQPNP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G060060`
TK1151 ID	TkA03G060060
OH-1004 ID	LXL04_039344
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	63.200
Protein coverage (%)	TK1151 19.205 / OH-1004 29.965 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G060060

Location Chr03:15441449-15443241 (+)

Description Similar to PDCB2: PLASMODESMATA CALLOSE-BINDING PROTEIN 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11820`	Glucan endo-1,3-beta-glucosidase 1.	No verified direct reference in this release
`At2g01630`	Glucan endo-1,3-beta-glucosidase 3.	No verified direct reference in this release
`At1g66250`	Glucan endo-1,3-beta-glucosidase 2.	No verified direct reference in this release
`At5g56590`	Glucan endo-1,3-beta-glucosidase 13.	No verified direct reference in this release
`At4g29360`	Glucan endo-1,3-beta-glucosidase 12.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039344 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0009408 response to heat Biological Process

GO:0052543 callose deposition in cell wall Biological Process

GO:0071555 cell wall organization Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT1G18650

ath:AT3G13560

ath:AT5G08000

ath:AT5G56590

ath:AT5G61130

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.364

Rank 1 · TkA03G060060 · TK1151

Endoplasmic reticulum0.213

Rank 2 · TkA03G060060 · TK1151

Extracellular0.163

Rank 3 · TkA03G060060 · TK1151

Cytoplasm0.151

Rank 4 · TkA03G060060 · TK1151

Nucleus0.144

Rank 5 · TkA03G060060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00332Glyco_hydro_17106-195 aa

PF07983X8366-437 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G060060	`PF00332`	Glyco_hydro_17	106	195	5.5e-06	26.9
TkA03G060060	`PF07983`	X8	366	437	4.9e-24	85.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65399`	Arabidopsis thaliana	sp\|O65399\|E131_ARATH Glucan endo-1,3-beta-glucosidase 1	47.100%	Swiss-Prot	Low
`Q9ZU91`	Arabidopsis thaliana	sp\|Q9ZU91\|E133_ARATH Glucan endo-1,3-beta-glucosidase 3	48.300%	Swiss-Prot	Low
`Q9C7U5`	Arabidopsis thaliana	sp\|Q9C7U5\|E132_ARATH Glucan endo-1,3-beta-glucosidase 2	43.700%	Swiss-Prot	Low
`Q9FJU9`	Arabidopsis thaliana	sp\|Q9FJU9\|E1313_ARATH Glucan endo-1,3-beta-glucosidase 13	39.600%	Swiss-Prot	Low
`Q8VYE5`	Arabidopsis thaliana	sp\|Q8VYE5\|E1312_ARATH Glucan endo-1,3-beta-glucosidase 12	39.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card