TkA03G031950 | RubberDandelionOmics

Gene overview

TkA03G031950

Reference: TK1151 Chr: Chr03 Coordinates: 8543421-8545231 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1444 bp · TkA03G031950|TK1151|cDNA

GAAATATCTTTAATTTGAAAAGAGAATTGAAATGAAATAACAGTCTGGTAATGGTGGGCGTGCCAGCTCACCTCAATTCATAGTATAATATGGAATCGAGCAATCTATAACTATCATCCTCCTTGTCCTTTCCCAACCACACTTGAATCTTTCCATATCTTATTAAGAATCTTAACAATTTTCAACATAAGATATGACACTCGAAGACACCATGAAGGTTGAGGTAGAATCCAACTGCCCGCCGGAGCCACCCGTCGCCG...

CDS

Download CDS FASTA

570 bp · TkA03G031950|TK1151|CDS

ATGACACTCGAAGACACCATGAAGGTTGAGGTAGAATCCAACTGCCCGCCGGAGCCACCCGTCGCCGCCGAAGAAAAAGCTATTGTCCCAGTCGAACCTCCTGTTCTTGAAGAGAAGACCACCGACGATTCTAAAGCTCTCGCCATCGTCGAAAAGCCAACAGAAGCATGTGAGGAGAAACCTAAAGAGGGGTCTATCAACAGAGACGATGTTCTTGCTAAAGTAGCAACAGAGAAGAAATTAGCACTTATTACAGCATG...

Protein

Download Protein FASTA

189 aa · TkA03G031950|TK1151|PROTEIN

MTLEDTMKVEVESNCPPEPPVAAEEKAIVPVEPPVLEEKTTDDSKALAIVEKPTEACEEKPKEGSINRDDVLAKVATEKKLALITAWEESEKSKAENRAQQKLTSIIAWENSKKADLEAELKKMEEDLEKKKAKYIEKMKNKIVLLHKKAEEKKALTEAKCGEEIIKAEEVAAKCRATGETPKKLLGWF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G031950`
TK1151 ID	TkA03G031950
OH-1004 ID	LXL04_011889
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G031950

Location Chr03:8543421-8545231 (+)

Description Similar to Remorin

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45820`	Exhibits a non sequence-specific DNA-binding activity.	No verified direct reference in this release
`At3g61260`	Uncharacterized protein At3g61260.	No verified direct reference in this release
`At5g23750`	Remorin 1.4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011889 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007267 cell-cell signaling Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0010555 response to mannitol Biological Process

GO:0051607 defense response to virus Biological Process

GO:0051665 membrane raft localization Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G41870

ath:AT2G45820

ath:AT3G61260

ath:AT5G23750

sot:102577743

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.464

Rank 1 · TkA03G031950 · TK1151

Cytoplasm0.298

Rank 2 · TkA03G031950 · TK1151

Nucleus0.194

Rank 3 · TkA03G031950 · TK1151

Endoplasmic reticulum0.078

Rank 4 · TkA03G031950 · TK1151

Plastid0.060

Rank 5 · TkA03G031950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03766Remorin_N23-75 aa

PF29950ASG775-151 aa

PF03763Remorin_C79-184 aa

PF03766Remorin_N88-94 aa

PF01949Endo_dU107-184 aa

PF03766Remorin_N123-133 aa

PF03766Remorin_N148-156 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G031950	`PF03766`	Remorin_N	23	75	9.9e-17	61.4
TkA03G031950	`PF29950`	ASG7	75	151	2.0	9.1
TkA03G031950	`PF03763`	Remorin_C	79	184	2.2e-31	108.5
TkA03G031950	`PF03766`	Remorin_N	88	94	9.9e-17	61.4
TkA03G031950	`PF01949`	Endo_dU	107	184	0.16	12.0
TkA03G031950	`PF03766`	Remorin_N	123	133	9.9e-17	61.4
TkA03G031950	`PF03766`	Remorin_N	148	156	9.9e-17	61.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80837`	Arabidopsis thaliana	sp\|O80837\|REMO_ARATH Remorin	52.400%	Swiss-Prot	High
`Q9M2D8`	Arabidopsis thaliana	sp\|Q9M2D8\|Y3126_ARATH Uncharacterized protein At3g61260	51.000%	Swiss-Prot	High
`Q9FFA5`	Arabidopsis thaliana	sp\|Q9FFA5\|RMR14_ARATH Remorin 1.4	39.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card