LXL04_011889 | RubberDandelionOmics

Gene overview

LXL04_011889

Reference: OH-1004 Chr: Chr03 Coordinates: 2339227-2340163 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

570 bp · LXL04_011889|LXL04_011889|OH1004|cDNA

ATGACACTCGAAGACACCATGAAGGTTGAGGTAGAATCCAACTGCCCGCCGGAGCCACCCGTCGCCGCCGAAGAAAAAGCTATTGTCCCAGTCGAACCTCCTGTTCTTGAAGAGAAGACCACCGACGATTCTAAAGCTCTCGCCATCGTCGAAAAGCCAACAGAAGCATGTGAGGAGAAACCTAAAGAGGGGTCTATCAACAGAGACGATGTTCTTGCTAAAGTAGTAACAGAGAAGAAATTAGCACTTATTACAGCATG...

CDS

Download CDS FASTA

570 bp · LXL04_011889|LXL04_011889|OH1004|CDS

ATGACACTCGAAGACACCATGAAGGTTGAGGTAGAATCCAACTGCCCGCCGGAGCCACCCGTCGCCGCCGAAGAAAAAGCTATTGTCCCAGTCGAACCTCCTGTTCTTGAAGAGAAGACCACCGACGATTCTAAAGCTCTCGCCATCGTCGAAAAGCCAACAGAAGCATGTGAGGAGAAACCTAAAGAGGGGTCTATCAACAGAGACGATGTTCTTGCTAAAGTAGTAACAGAGAAGAAATTAGCACTTATTACAGCATG...

Protein

Download Protein FASTA

189 aa · LXL04_011889|LXL04_011889|OH1004|PROTEIN

MTLEDTMKVEVESNCPPEPPVAAEEKAIVPVEPPVLEEKTTDDSKALAIVEKPTEACEEKPKEGSINRDDVLAKVVTEKKLALITAWEESEKSKAENRAQQKLTSIIAWENSKKADLEAELKKMEEDLEKKKAKYIEKMKNKIVLLHKKAEEKKALTEAKCGEEIIKAEEVAAKCRATGETPKKLLGWF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011889`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011889

Location Chr03:2339227-2340163 (-)

Description Similar to Remorin

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23750`	Remorin 1.4.	No verified direct reference in this release
`At3g61260`	Uncharacterized protein At3g61260.	No verified direct reference in this release
`At2g45820`	Exhibits a non sequence-specific DNA-binding activity.	No verified direct reference in this release
`At2g41870`	Collaborates with REM4.1 to positively regulate the BCTV and BSCTV susceptibility.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011889 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007267 cell-cell signaling Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0010555 response to mannitol Biological Process

GO:0051607 defense response to virus Biological Process

GO:0051665 membrane raft localization Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G41870

ath:AT2G45820

ath:AT3G61260

ath:AT5G23750

sot:102577743

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.452

Rank 1 · LXL04_011889 · OH-1004

Cytoplasm0.301

Rank 2 · LXL04_011889 · OH-1004

Nucleus0.196

Rank 3 · LXL04_011889 · OH-1004

Endoplasmic reticulum0.079

Rank 4 · LXL04_011889 · OH-1004

Plastid0.063

Rank 5 · LXL04_011889 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03766.19Remorin_N23-75 aa

PF03763.19Remorin_C79-184 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011889	`PF03766.19`	Remorin_N	23	75	9.9e-17	61.4
LXL04_011889	`PF03763.19`	Remorin_C	79	184	2.3e-31	108.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFA5`	Arabidopsis thaliana	Remorin 1.4	69.355%	Swiss-Prot	moderate database homology
`Q9M2D8`	Arabidopsis thaliana	Uncharacterized protein At3g61260	57.143%	Swiss-Prot	strong database homology
`O80837`	Arabidopsis thaliana	Remorin	56.021%	Swiss-Prot	strong database homology
`P93758`	Arabidopsis thaliana	Remorin 4.2	39.806%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card