TkA03G007950 | RubberDandelionOmics

Gene overview

TkA03G007950

Reference: TK1151 Chr: Chr03 Coordinates: 1936647-1939017 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1408 bp · TkA03G007950|TK1151|cDNA

CAACCTCTTCTCCGCCTTTCATGCTACCTTTTCATGCATATATAGCCTCTACTACCCACTCCACTTACTCCACCATCACAGCAAATCTACAAACACATTCCTCTCCTTAGTTCTCAATACTTCTCGTATCAGTTAATCATGGCAAAGGTCAAGATCGGAATCAATGGATTTGGAAGAATTGGCCGATTGGTTGCCAGAGTTGCTCTAATGAGCGATGATATTGAACTCGTTGCCGTTAATGATCCTTTCATTACTACCGA...

CDS

Download CDS FASTA

1008 bp · TkA03G007950|TK1151|CDS

ATGGCAAAGGTCAAGATCGGAATCAATGGATTTGGAAGAATTGGCCGATTGGTTGCCAGAGTTGCTCTAATGAGCGATGATATTGAACTCGTTGCCGTTAATGATCCTTTCATTACTACCGATTACATGATCTACATGTTTAAGTACGATAGTGTTCACGGCCAATGGAAACAAGACATCAAAGTGAAGGATTCCAAAACTCTTCTCTTTGGAGATAAACCAGTAACTGTTTTTGGCATGAGAAATCCAGAAGAAATCCC...

Protein

Download Protein FASTA

335 aa · TkA03G007950|TK1151|PROTEIN

MAKVKIGINGFGRIGRLVARVALMSDDIELVAVNDPFITTDYMIYMFKYDSVHGQWKQDIKVKDSKTLLFGDKPVTVFGMRNPEEIPWGEAGAEYVVESTGVFTDKDKAAAHMKGGAKKVVISAPSANAPMFVMGVNEKEYKSDITIVSNASCTTNCLAPLAKVINDKFGIVEGLMTTVHSITATQKTVDGPSMKDWRGGRAASFNIIPSSTGAAKAVGKVLPALNGKLTGMAFRVPTVDVSVVDLTVRLEKPASYDDIK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G007950`
TK1151 ID	TkA03G007950
OH-1004 ID	LXL04_006066
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	91.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G007950

Location Chr03:1936647-1939017 (-)

Description Similar to GAPC: Glyceraldehyde-3-phosphate dehydrogenase, cytosolic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0486600`	Key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006066 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006006 glucose metabolic process Biological Process

GO:0006096 glycolytic process Biological Process

GO:0009408 response to heat Biological Process

GO:0034059 response to anoxia Biological Process

GO:0005829 cytosol Cellular Component

GO:0032991 protein-containing complex Cellular Component

GO:0004365 glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity Molecular Function

GO:0042301 phosphate ion binding Molecular Function

GO:0050661 NADP binding Molecular Function

GO:0051287 NAD binding Molecular Function

GO:0070403 NAD+ binding Molecular Function

KEGG gene cross-reference

dosa:Os02g0601300

dosa:Os04g0486600

zma:542333

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.822

Rank 1 · TkA03G007950 · TK1151

Nucleus0.261

Rank 2 · TkA03G007950 · TK1151

Mitochondrion0.083

Rank 3 · TkA03G007950 · TK1151

Cell membrane0.077

Rank 4 · TkA03G007950 · TK1151

Endoplasmic reticulum0.055

Rank 5 · TkA03G007950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF028262-Hacid_dh_C3-23 aa

PF00044Gp_dh_N4-106 aa

PF01113DapB_N4-35 aa

PF01113DapB_N92-112 aa

PF02800Gp_dh_C152-317 aa

PF00044Gp_dh_N291-323 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G007950	`PF02826`	2-Hacid_dh_C	3	23	0.11	12.6
TkA03G007950	`PF00044`	Gp_dh_N	4	106	3.4e-35	121.1
TkA03G007950	`PF01113`	DapB_N	4	35	0.017	15.9
TkA03G007950	`PF01113`	DapB_N	92	112	0.017	15.9
TkA03G007950	`PF02800`	Gp_dh_C	152	317	1.5e-75	253.3
TkA03G007950	`PF00044`	Gp_dh_N	291	323	3.4e-35	121.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7FAH2`	Oryza sativa subsp. japonica	sp\|Q7FAH2\|G3PC2_ORYSJ Glyceraldehyde-3-phosphate dehydrogenase 2, cytosolic	90.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card