LXL04_006066 | RubberDandelionOmics

Gene overview

LXL04_006066

Reference: OH-1004 Chr: Chr02 Coordinates: 1294658-1296625 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1098 bp · LXL04_006066|LXL04_006066|OH1004|cDNA

ATGGCAAAGGTCAAGATCGGAATCAATGGATTTGGAAGAATTGGCCGATTGGTTGCCAGAGTTGCTCTAATGAGCGATGATATTGAACTCGTTGCCGTTAATGATCCTTTCATTACTACCGATTACATGATCTACATGTTTAAGTACGATAGTGTTCACGGCCAATGGAAACAAGACATCAAAGTGAAGGATTCCAAAACTCTTCTCTTTGGAGATAAACCAGTAACTGTTTTTGGCATGAGGTACGTTTCTCCATTCTT...

CDS

Download CDS FASTA

1098 bp · LXL04_006066|LXL04_006066|OH1004|CDS

ATGGCAAAGGTCAAGATCGGAATCAATGGATTTGGAAGAATTGGCCGATTGGTTGCCAGAGTTGCTCTAATGAGCGATGATATTGAACTCGTTGCCGTTAATGATCCTTTCATTACTACCGATTACATGATCTACATGTTTAAGTACGATAGTGTTCACGGCCAATGGAAACAAGACATCAAAGTGAAGGATTCCAAAACTCTTCTCTTTGGAGATAAACCAGTAACTGTTTTTGGCATGAGGTACGTTTCTCCATTCTT...

Protein

Download Protein FASTA

365 aa · LXL04_006066|LXL04_006066|OH1004|PROTEIN

MAKVKIGINGFGRIGRLVARVALMSDDIELVAVNDPFITTDYMIYMFKYDSVHGQWKQDIKVKDSKTLLFGDKPVTVFGMRYVSPFFQFNNNNNNNKLLLHVVHLSQILYRNPEEIPWGEAGAEYVVESTGVFTDKDKAAAHMKGGAKKVVISAPSANAPMFVMGVNEKEYKSDITIVSNASCTTNCLAPLAKVINDKFGIVEGLMTTVHSITATQKTVDGPSMKDWRGGRAASFNIIPSSTGAAKAVGKVLPALNGKLT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006066`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006066

Location Chr02:1294658-1296625 (-)

Description Similar to GAPC: Glyceraldehyde-3-phosphate dehydrogenase, cytosolic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0486600`	Key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate.	No verified direct reference in this release
`Os02g0601300`	Key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006066 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006006 glucose metabolic process Biological Process

GO:0006096 glycolytic process Biological Process

GO:0009408 response to heat Biological Process

GO:0034059 response to anoxia Biological Process

GO:0005829 cytosol Cellular Component

GO:0032991 protein-containing complex Cellular Component

GO:0004365 glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity Molecular Function

GO:0042301 phosphate ion binding Molecular Function

GO:0050661 NADP binding Molecular Function

GO:0051287 NAD binding Molecular Function

GO:0070403 NAD+ binding Molecular Function

KEGG gene cross-reference

dosa:Os02g0601300

dosa:Os04g0486600

zma:542333

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.726

Rank 1 · LXL04_006066 · OH-1004

Nucleus0.235

Rank 2 · LXL04_006066 · OH-1004

Mitochondrion0.110

Rank 3 · LXL04_006066 · OH-1004

Peroxisome0.096

Rank 4 · LXL04_006066 · OH-1004

Cell membrane0.074

Rank 5 · LXL04_006066 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00044.31Gp_dh_N4-80 aa

PF00044.31Gp_dh_N87-136 aa

PF02800.27Gp_dh_C182-347 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006066	`PF00044.31`	Gp_dh_N	4	80	6.6e-32	110.5
LXL04_006066	`PF00044.31`	Gp_dh_N	87	136	6.6e-32	110.5
LXL04_006066	`PF02800.27`	Gp_dh_C	182	347	1.8e-75	253.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7FAH2`	Oryza sativa subsp. japonica	Glyceraldehyde-3-phosphate dehydrogenase 2, cytosolic	82.645%	Swiss-Prot	strong database homology
`Q6K5G8`	Oryza sativa subsp. japonica	Glyceraldehyde-3-phosphate dehydrogenase 3, cytosolic	80.441%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card