TkA03G007330 | RubberDandelionOmics

Gene overview

TkA03G007330

Reference: TK1151 Chr: Chr03 Coordinates: 1760866-1763397 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1833 bp · TkA03G007330|TK1151|cDNA

AATTAAGCGATAGTCGCTACCCACAAAAATGAACCGATTCAAAATGAGTATATGACGCGAATTTAACCTGGCTATGATATTTAAGCGGCTGATATTTTATTCTAGAGACCAAACCAACCATATCTTCTTCCTCCAAATTCTACTCCATAGAATCACATATAAGCTCATCACGCCTTCATCTTTCACTAAACCAGTACAAATGAATTCCCTCAGTCTCTTTGGTCCGTCCGACACCCTCCCTCTCTTCGGTGCTGCCTCCG...

CDS

Download CDS FASTA

1566 bp · TkA03G007330|TK1151|CDS

ATGATATTTAAGCGGCTGATATTTTATTCTAGAGACCAAACCAACCATATCTTCTTCCTCCAAATTCTACTCCATAGAATCACATATAAGCTCATCACGCCTTCATCTTTCACTAAACCAGTACAAATGAATTCCCTCAGTCTCTTTGGTCCGTCCGACACCCTCCCTCTCTTCGGTGCTGCCTCCGCCTCCATTTCTTCCCGGACGCAACTTTCTTTCCCTCAGAGGCTTTTCTTCTGTCGCGCAGAAACGGATGCATC...

Protein

Download Protein FASTA

521 aa · TkA03G007330|TK1151|PROTEIN

MIFKRLIFYSRDQTNHIFFLQILLHRITYKLITPSSFTKPVQMNSLSLFGPSDTLPLFGAASASISSRTQLSFPQRLFFCRAETDASVSLVNVPPNLLLAEREEAKAVLHMFLTNQGMNRLTAARKMKKLDRFVDHLMLRLHTVYKTRYLVGRELTTPEIRDTLIPYLDEFVEEHGENFVEVLEYFPIPLVKEQKDETAQFHPSDLLEPSTNNPDQLLEKTTSRVNPNTETPNLPPHVVYLEEELGMELEVIKEVIRKFP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G007330`
TK1151 ID	TkA03G007330
OH-1004 ID	LXL04_006055
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G007330

Location Chr03:1760866-1763397 (+)

Description Similar to MTERF5: Transcription termination factor MTERF5, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14605`	Transcription termination factor required for processing and steady-state levels of plastid transcripts.	Arabidopsis MDA1, a nuclear-encoded protein, functions in chloroplast development and abiotic stress responses.2012 · DOI: 10.1371/journal.pone.0042924 mTERF5 Acts as a Transcriptional Pausing Factor to Positively Regulate Transcription of Chloroplast psbEFLJ.2019 · DOI: 10.1016/j.molp.2019.05.007

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006055 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006353 DNA-templated transcription termination Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0008033 tRNA processing Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0042793 plastid transcription Biological Process

GO:0071452 cellular response to singlet oxygen Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT2G03050

ath:AT2G21710

ath:AT4G14605

ath:AT4G38160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.907

Rank 1 · TkA03G007330 · TK1151

Mitochondrion0.097

Rank 2 · TkA03G007330 · TK1151

Nucleus0.032

Rank 3 · TkA03G007330 · TK1151

Cytoplasm0.028

Rank 4 · TkA03G007330 · TK1151

Cell membrane0.014

Rank 5 · TkA03G007330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02536mTERF238-350 aa

PF20207PedC-like256-294 aa

PF22357AF1548-like_C276-299 aa

PF22357AF1548-like_C303-331 aa

PF20207PedC-like327-364 aa

PF02536mTERF338-506 aa

PF22357AF1548-like_C344-369 aa

PF19499DUF6034405-460 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G007330	`PF02536`	mTERF	238	350	6.2e-51	173.9
TkA03G007330	`PF20207`	PedC-like	256	294	0.14	12.9
TkA03G007330	`PF22357`	AF1548-like_C	276	299	0.05	14.4
TkA03G007330	`PF22357`	AF1548-like_C	303	331	0.05	14.4
TkA03G007330	`PF20207`	PedC-like	327	364	0.14	12.9
TkA03G007330	`PF02536`	mTERF	338	506	6.2e-51	173.9
TkA03G007330	`PF22357`	AF1548-like_C	344	369	0.05	14.4
TkA03G007330	`PF19499`	DUF6034	405	460	0.31	10.3
TkA03G007330	`PF03698`	UPF0180	407	429	0.16	12.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JVI3`	Arabidopsis thaliana	sp\|F4JVI3\|MTEF5_ARATH Transcription termination factor MTERF5, chloroplastic	54.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card