TkA02G614480 | RubberDandelionOmics

Gene overview

TkA02G614480

Reference: TK1151 Chr: Chr02 Coordinates: 158454419-158455707 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1184 bp · TkA02G614480|TK1151|cDNA

TGTTAAGGCCCAACCTCCCCGGATTGGTATTTTAACACATCACTCAACAAGATAGCTCGCACTATTTACCTCATCGATCCTGTCCCGAATAATTCATTCATCGATCTGGTGGTTTTAATTTGTCAATCAGATGGTTGATCTGGTATCCAGTAACTACTAAAGAGCATGAGAAAATGTTAAGAGGTAATTCAGAAAAGAATATTGATGATACGGGAATGCAGAGGAAGAAGAAGAAAAGCAAGAGCGAGAAGAATCAGACG...

CDS

Download CDS FASTA

648 bp · TkA02G614480|TK1151|CDS

ATGTTAAGAGGTAATTCAGAAAAGAATATTGATGATACGGGAATGCAGAGGAAGAAGAAGAAAAGCAAGAGCGAGAAGAATCAGACGAGGAGGTTTAGTGATGAGCAGATAAAATCACTGGAGTCGCTGTTCGAGATGGAGAACAAGCTGGAACCAAGAAAGAAGGTGGAGATGGCCACGCAACTGGGGCTGCACCCTCGTCAAGTGGCTATCTGGTTTCAAAACAGAAGGGCTCGTTGGAAGTCCAAGCAAGTCGAGCA...

Protein

Download Protein FASTA

215 aa · TkA02G614480|TK1151|PROTEIN

MLRGNSEKNIDDTGMQRKKKKSKSEKNQTRRFSDEQIKSLESLFEMENKLEPRKKVEMATQLGLHPRQVAIWFQNRRARWKSKQVEHDYTSLKADYDSLAHRFESLKKEKHALIQQLRDVCNQLKEPYEGTKDLDNGSENEDTNLELNKGNSNGPMERDMAIYYVDQDDPCRKEESENLNVGVTDDQFSHEKGSSVDPSSLFYQSNWWDVWSSNS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G614480`
TK1151 ID	TkA02G614480
OH-1004 ID	LXL04_011797
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G614480

Location Chr02:158454419-158455707 (+)

Description Similar to ATHB-7: Homeobox-leucine zipper protein ATHB-7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g46680`	Probable transcription activator that may act as growth regulators in response to water deficit.	The Arabidopsis homeobox gene ATHB-7 is induced by water deficit and by abscisic acid.1996 · DOI: 10.1046/j.1365-313x.1996.10020375.x
`At3g61890`	Probable transcription activator that may act as growth regulators in response to water deficit.	Structure and expression of the Arabidopsis thaliana homeobox gene Athb-12.2001 · DOI: 10.1006/bbrc.2001.4904

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q9XH35`	Probable transcription factor that binds to the DNA sequence 5'-CAAT[AT]ATTG-3'.	No verified direct reference in this release
`Os09g0528200`	Probable transcription factor that binds to the DNA sequence 5'-CAAT[AT]ATTG-3'.	No verified direct reference in this release
`UniProt: Q01IK0`	Probable transcription factor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011797 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009615 response to virus Biological Process

GO:0009725 response to hormone Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0033993 response to lipid Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT2G46680

ath:AT3G61890

dosa:Os04g0541700

dosa:Os09g0528200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.979

Rank 1 · TkA02G614480 · TK1151

Cytoplasm0.083

Rank 2 · TkA02G614480 · TK1151

Cell membrane0.020

Rank 3 · TkA02G614480 · TK1151

Endoplasmic reticulum0.010

Rank 4 · TkA02G614480 · TK1151

Plastid0.008

Rank 5 · TkA02G614480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19220Rod_CreS16-140 aa

PF00046Homeodomain30-81 aa

PF25450Rab11-FIP334-139 aa

PF05920Homeobox_KN53-79 aa

PF02183HALZ83-119 aa

PF05920Homeobox_KN108-117 aa

PF02183HALZ117-129 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G614480	`PF19220`	Rod_CreS	16	140	0.075	12.9
TkA02G614480	`PF00046`	Homeodomain	30	81	1e-17	64.4
TkA02G614480	`PF25450`	Rab11-FIP3	34	139	0.0095	16.9
TkA02G614480	`PF05920`	Homeobox_KN	53	79	0.00032	21.2
TkA02G614480	`PF02183`	HALZ	83	119	1.3e-13	51.5
TkA02G614480	`PF05920`	Homeobox_KN	108	117	0.00032	21.2
TkA02G614480	`PF02183`	HALZ	117	129	1.3e-13	51.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P46897`	Arabidopsis thaliana	sp\|P46897\|ATHB7_ARATH Homeobox-leucine zipper protein ATHB-7	68.800%	Swiss-Prot	Low
`Q9M276`	Arabidopsis thaliana	sp\|Q9M276\|ATB12_ARATH Homeobox-leucine zipper protein ATHB-12	64.200%	Swiss-Prot	Low
`Q9XH35`	Oryza sativa subsp. indica	sp\|Q9XH35\|HOX6_ORYSI Homeobox-leucine zipper protein HOX6	67.200%	Swiss-Prot	Low
`Q651Z5`	Oryza sativa subsp. japonica	sp\|Q651Z5\|HOX6_ORYSJ Homeobox-leucine zipper protein HOX6	67.200%	Swiss-Prot	Low
`Q01IK0`	Oryza sativa subsp. indica	sp\|Q01IK0\|HOX22_ORYSI Homeobox-leucine zipper protein HOX22	66.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card