TkA02G611820 | RubberDandelionOmics

Gene overview

TkA02G611820

Reference: TK1151 Chr: Chr02 Coordinates: 157819477-157821189 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1304 bp · TkA02G611820|TK1151|cDNA

TTTGAACTCACCATCTCCCTCACCTGTCAGCCATGTCAGCCTTCGTCGGAAAGTACGCCGATGAGTTAATCAAGAATGCCAAGTACATCGCCACACCGGGGAAGGGTATATTGGCGGCGGATGAAAGCACCGGAACCATCGGAAAACGTCTCTCGAGCATCAACGTCGAAAACGTCGAGTCAAACCGCCAAGCTCTTCGTGAACTCCTCTTCACAGCTCCGAACGCAGTGACTTACCTTTCCGGCGTCATTCTCTTCGAA...

CDS

Download CDS FASTA

939 bp · TkA02G611820|TK1151|CDS

ATGTCAGCCTTCGTCGGAAAGTACGCCGATGAGTTAATCAAGAATGCCAAGTACATCGCCACACCGGGGAAGGGTATATTGGCGGCGGATGAAAGCACCGGAACCATCGGAAAACGTCTCTCGAGCATCAACGTCGAAAACGTCGAGTCAAACCGCCAAGCTCTTCGTGAACTCCTCTTCACAGCTCCGAACGCAGTGACTTACCTTTCCGGCGTCATTCTCTTCGAAGAAACTCTTTACCAAAAGACCGCCGACGGGAA...

Protein

Download Protein FASTA

312 aa · TkA02G611820|TK1151|PROTEIN

MSAFVGKYADELIKNAKYIATPGKGILAADESTGTIGKRLSSINVENVESNRQALRELLFTAPNAVTYLSGVILFEETLYQKTADGKPFVDVLLEANVLPGIKVDKGYYEAGARFAKWRAVLKIGATEPSELSIQQNAQGLARYAINCQENGLVPIVEPEILTDGSHDIKKCAYATEMVLAAVYKALNEQHVLLEGTLLKPNMVTPGSDSPKVAPEVIAEYTVTALRRTVPAAVPGIVFLSGGQSEEQATVNLNAMNKLE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G611820`
TK1151 ID	TkA02G611820
OH-1004 ID	LXL04_037264
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	91.800
Protein coverage (%)	TK1151 97.115 / OH-1004 91.877 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G611820

Location Chr02:157819477-157821189 (+)

Description Similar to FBA5: Fructose-bisphosphate aldolase 5, cytosolic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g26530`	Fructose-bisphosphate aldolase that plays a key role in glycolysis and gluconeogenesis.	No verified direct reference in this release
`At4g26520`	Plays a key role in glycolysis and gluconeogenesis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0905800`	Fructose-bisphosphate aldolase that plays a key role in glycolysis and gluconeogenesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037264 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001666 response to hypoxia Biological Process

GO:0006094 gluconeogenesis Biological Process

GO:0006096 glycolytic process Biological Process

GO:0030388 fructose 1,6-bisphosphate metabolic process Biological Process

GO:0031930 mitochondria-nucleus signaling pathway Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT2G36460

ath:AT4G26520

ath:AT4G26530

dosa:Os01g0905800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.726

Rank 1 · TkA02G611820 · TK1151

Nucleus0.253

Rank 2 · TkA02G611820 · TK1151

Mitochondrion0.088

Rank 3 · TkA02G611820 · TK1151

Extracellular0.082

Rank 4 · TkA02G611820 · TK1151

Peroxisome0.068

Rank 5 · TkA02G611820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00274Glycolytic11-107 aa

PF00274Glycolytic107-304 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G611820	`PF00274`	Glycolytic	11	107	3.2e-144	480.8
TkA02G611820	`PF00274`	Glycolytic	107	304	3.2e-144	480.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65581`	Arabidopsis thaliana	sp\|O65581\|ALFC5_ARATH Fructose-bisphosphate aldolase 5, cytosolic	80.700%	Swiss-Prot	High
`P22197`	Arabidopsis thaliana	sp\|P22197\|ALFC7_ARATH Fructose-bisphosphate aldolase 7, cytosolic	75.600%	Swiss-Prot	High
`Q5N725`	Oryza sativa subsp. japonica	sp\|Q5N725\|ALFC3_ORYSJ Fructose-bisphosphate aldolase 3, cytoplasmic	75.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card