RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G600390
Reference: TK1151 Chr: Chr02 Coordinates: 154802018-154804645 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2081 bp · TkA02G600390|TK1151|cDNA

AAAAAAATAGGGAAAATAGAAAAACAAGAAGAGGACAAATACATCAGCTTCATAAGTGTAAAACATAACACAGGAACATAACTAAAGTGGGGAGCGTTTTTAATTTTGGGTTAAATTGGGCAAAGCTCAAGAAGGAGACCACCAGAGCCCACAGCATAACCTCCCCTCTCGTGGGGAGAATTGATTTCTAAATCCACTTCAACGTTCTTGAATCTATCTCTCTATCTCTCTCCACTCTCCAGATCCAGCTGGAGTTGTTC...

CDS

Download CDS FASTA

1437 bp · TkA02G600390|TK1151|CDS

ATGGCCGTTGCCAAGAGCGACACCAAAAGATATAACGAATCATCTTTCAAATTCCACAACTGTTTCAAAGTCGATACCTTATCGGAAACCATTCTACAAACCGAACAGATCTCAAATCTAAGAGATCGATATGTTCTCGGTGACCAATTGGGATGGGGGCAGTTCGGTGTAATCCGAGAATGCTCAGATAAATTCACCGGCGTTTTATTAGCCTGCAAATCAATTTCAAAAAACAGACTCGTGACTGATGAAGACGTAAG...

Protein

Download Protein FASTA

478 aa · TkA02G600390|TK1151|PROTEIN

MAVAKSDTKRYNESSFKFHNCFKVDTLSETILQTEQISNLRDRYVLGDQLGWGQFGVIRECSDKFTGVLLACKSISKNRLVTDEDVRSIKLEIEIMTRLSGHPNVVDLKAVYEEEGYVHLVMELCAGGELFHRLEKQGRFSEFEARILFKHLMQVVQFCHDKGVVHRDLKPENILLATKASSSQIKLADFGLATYIKPGQSLHGTVGSPFYIAPEVLAGGYNQAADVWSAGVILYILLSGKPPFWGKTKSRIFDAVRAAG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G600390
TK1151 IDTkA02G600390
OH-1004 IDLXL04_011964
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)98.100
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G600390
LocationChr02:154802018-154804645 (+)
DescriptionSimilar to CPK6: Calcium-dependent protein kinase 6
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g17290 May play a role in signal transduction pathways that involve calcium as a second messenger.
CDPKs CPK6 and CPK3 function in ABA regulation of guard cell S-type anion- and Ca(2+)-permeable channels and stomatal closure.2006 · DOI: 10.1371/journal.pbio.0040327
Calcium-dependent protein kinases responsible for the phosphorylation of a bZIP transcription factor FD crucial for the florigen complex formation.2015 · DOI: 10.1038/srep08341
At4g38230 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0584600 May play a role in signal transduction pathways that involve calcium as a second messenger (By similarity). No verified direct reference in this release
Os02g0685900 May play a role in signal transduction pathways that involve calcium as a second messenger. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_011964 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009409 response to cold Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0010119 regulation of stomatal movement Biological Process
GO:0035556 intracellular signal transduction Biological Process
GO:0046777 protein autophosphorylation Biological Process
GO:1901002 positive regulation of response to salt stress Biological Process
GO:1902456 regulation of stomatal opening Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0005829 cytosol Cellular Component
KEGG gene cross-reference
ath:AT2G17290
ath:AT4G38230
dosa:Os02g0685900
dosa:Os04g0584600
osa:4336783
sot:102604043
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.566
Rank 1 · TkA02G600390 · TK1151
Nucleus0.481
Rank 2 · TkA02G600390 · TK1151
Cell membrane0.078
Rank 3 · TkA02G600390 · TK1151
Mitochondrion0.050
Rank 4 · TkA02G600390 · TK1151
Endoplasmic reticulum0.045
Rank 5 · TkA02G600390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01633Choline_kinase35-61 aa
PF00069Pkinase44-301 aa
PF07714PK_Tyr_Ser-Thr46-297 aa
PF01636APH85-132 aa
PF01163RIO1119-179 aa
PF03109ABC1120-198 aa
PF01636APH122-198 aa
PF10707YrbL-PhoP_reg128-196 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G600390PF01633Choline_kinase35610.2411.4
TkA02G600390PF00069Pkinase443015.1e-73246.4
TkA02G600390PF07714PK_Tyr_Ser-Thr462974.7e-33115.3
TkA02G600390PF01636APH851320.003717.8
TkA02G600390PF01163RIO11191790.07313.4
TkA02G600390PF03109ABC11201980.000819.4
TkA02G600390PF01636APH1221980.003717.8
TkA02G600390PF10707YrbL-PhoP_reg1281960.02714.9
TkA02G600390PF06293Kdo1441900.01515.5
TkA02G600390PF14531Kinase-like1452520.004417.0
TkA02G600390PF01633Choline_kinase1501990.2411.4
TkA02G600390PF17667Pkinase_fungal1592210.01914.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q38872Arabidopsis thalianasp|Q38872|CDPK6_ARATH Calcium-dependent protein kinase 654.100%Swiss-ProtMedium
Q9SZM3Arabidopsis thalianasp|Q9SZM3|CDPKQ_ARATH Calcium-dependent protein kinase 2653.700%Swiss-ProtMedium
Q9FXQ3Oryza sativa subsp. japonicasp|Q9FXQ3|CDPKD_ORYSJ Calcium-dependent protein kinase 1355.200%Swiss-ProtMedium
Q0DYK7Oryza sativa subsp. japonicasp|Q0DYK7|CDPK5_ORYSJ Calcium-dependent protein kinase 555.200%Swiss-ProtMedium

JBrowse

View in Genome Browser