LXL04_011964 | RubberDandelionOmics

Gene overview

LXL04_011964

Reference: OH-1004 Chr: Chr03 Coordinates: 3749151-3750744 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1431 bp · LXL04_011964|LXL04_011964|OH1004|cDNA

ATGGCCGTTGCCAAGAGCGACACCAAAAGATATAACGAATCATCTTTCAAATTCCACAACTGTTTCAAAGTCGATACCTTATCGGAAACCATTCTACAAACCGAACAGATCTCAAATCTAAGAGATCGATATGTTCTCGGTGACCAATTGGGATGGGGGCAGTTCGGTGTAATCCGAGAATGCTCAGATAAATTCACCGGAGATTTATTAGCCTGCAAATCAATTTCAAAAAACAGACTCGTGACTGATGAAGACGTAAG...

CDS

Download CDS FASTA

1431 bp · LXL04_011964|LXL04_011964|OH1004|CDS

ATGGCCGTTGCCAAGAGCGACACCAAAAGATATAACGAATCATCTTTCAAATTCCACAACTGTTTCAAAGTCGATACCTTATCGGAAACCATTCTACAAACCGAACAGATCTCAAATCTAAGAGATCGATATGTTCTCGGTGACCAATTGGGATGGGGGCAGTTCGGTGTAATCCGAGAATGCTCAGATAAATTCACCGGAGATTTATTAGCCTGCAAATCAATTTCAAAAAACAGACTCGTGACTGATGAAGACGTAAG...

Protein

Download Protein FASTA

476 aa · LXL04_011964|LXL04_011964|OH1004|PROTEIN

MAVAKSDTKRYNESSFKFHNCFKVDTLSETILQTEQISNLRDRYVLGDQLGWGQFGVIRECSDKFTGDLLACKSISKNRLVTDEDVRSIKLEIEIMTRLSGHPNVVDLKAVYEEEGYVHLVMELCAGGELFHRLEKQGRFSEFEARILFKHLMQVVQFCHDKGVVHRDLKPENILLATKASSSQIKLADFGLATYIKPGQSLHGTVGSPFYIAPEVLAGGYNQAADVWSAGVILYILLSGKPPFWGKTKSRIFDAVRAAG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011964`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011964

Location Chr03:3749151-3750744 (-)

Description Similar to CPK6: Calcium-dependent protein kinase 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g17290`	May play a role in signal transduction pathways that involve calcium as a second messenger.	CDPKs CPK6 and CPK3 function in ABA regulation of guard cell S-type anion- and Ca(2+)-permeable channels and stomatal closure.2006 · DOI: 10.1371/journal.pbio.0040327 Calcium-dependent protein kinases responsible for the phosphorylation of a bZIP transcription factor FD crucial for the florigen complex formation.2015 · DOI: 10.1038/srep08341
`At4g38230`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0584600`	May play a role in signal transduction pathways that involve calcium as a second messenger (By similarity).	No verified direct reference in this release
`Os02g0685900`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011964 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:1901002 positive regulation of response to salt stress Biological Process

GO:1902456 regulation of stomatal opening Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G17290

ath:AT4G38230

dosa:Os02g0685900

dosa:Os04g0584600

osa:4336783

sot:102604043

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.571

Rank 1 · LXL04_011964 · OH-1004

Nucleus0.477

Rank 2 · LXL04_011964 · OH-1004

Cell membrane0.077

Rank 3 · LXL04_011964 · OH-1004

Mitochondrion0.049

Rank 4 · LXL04_011964 · OH-1004

Endoplasmic reticulum0.044

Rank 5 · LXL04_011964 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase44-301 aa

PF07714.24PK_Tyr_Ser-Thr46-297 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011964	`PF00069.32`	Pkinase	44	301	1.7e-73	248.0
LXL04_011964	`PF07714.24`	PK_Tyr_Ser-Thr	46	297	1e-32	114.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q38872`	Arabidopsis thaliana	Calcium-dependent protein kinase 6	53.710%	Swiss-Prot	moderate database homology
`Q9SZM3`	Arabidopsis thaliana	Calcium-dependent protein kinase 26	53.676%	Swiss-Prot	moderate database homology
`Q9FXQ3`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 13	54.015%	Swiss-Prot	moderate database homology
`Q0DYK7`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 5	54.015%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card