TkA02G594100 | RubberDandelionOmics

Gene overview

TkA02G594100

Reference: TK1151 Chr: Chr02 Coordinates: 153278531-153282163 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2560 bp · TkA02G594100|TK1151|cDNA

AAATATCCCAAACCCTAAACCTTAACTCCTCCTCTTTCTCCCTTCTCCTCGCTACTGCAACGCAACCGCTAAAACCATATTTAGCAGGAAGGAGAACGCCCCCCTCTAATACCTTACACATACCATGCCTTCACTTGCCGTTCTACCTGAAACCCTATCCCCATCATCTGAAGTCCTCAAGACGAAGACCAAGAAGATGAAGAACGACACCTCCGAAACCGTCGGGCTCGAATCTTCAATCAAGAAAGAGAAAAAGAGCA...

CDS

Download CDS FASTA

2145 bp · TkA02G594100|TK1151|CDS

ATGCCTTCACTTGCCGTTCTACCTGAAACCCTATCCCCATCATCTGAAGTCCTCAAGACGAAGACCAAGAAGATGAAGAACGACACCTCCGAAACCGTCGGGCTCGAATCTTCAATCAAGAAAGAGAAAAAGAGCAAAAAGAATAAGACCGACACTCCTTCCGATACTGAAAAATCCGAGAAAAAAAGCAAGAAGAAACGTAAGGCTTCTTCGGATACAGATAACGAAGAAGGAAAGAGCGATACAAGCGAACTAGTCGA...

Protein

Download Protein FASTA

714 aa · TkA02G594100|TK1151|PROTEIN

MPSLAVLPETLSPSSEVLKTKTKKMKNDTSETVGLESSIKKEKKSKKNKTDTPSDTEKSEKKSKKKRKASSDTDNEEGKSDTSELVEPVNLKIEESMKKSKKKKTKTAEVDEEVEPIKEENPNAVSNFRVSEPLRNALKAKGIEALFPIQARTFDSIYDGLDLIGKAKTGQGKTLAFILPILESLINGPEKASRKTGYGRSPTILVLLPTRELAKQVFTDFKYYGESVGLTSCCLYGGGGASISPQTMQLKRGVDIVVGA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G594100`
TK1151 ID	TkA02G594100
OH-1004 ID	LXL04_011999
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 95.378 / OH-1004 56.122 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G594100

Location Chr02:153278531-153282163 (+)

Description Similar to RH7: DEAD-box ATP-dependent RNA helicase 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g62190`	DEAD-box ATP-dependent RNA helicase 7.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0520700`	DEAD-box ATP-dependent RNA helicase 7.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011999 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010584 pollen exine formation Biological Process

GO:0016070 RNA metabolic process Biological Process

GO:0080110 sporopollenin biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0016020 membrane Cellular Component

GO:0003724 RNA helicase activity Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0004497 monooxygenase activity Molecular Function

GO:0005506 iron ion binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G69500

ath:AT5G62190

dosa:Os09g0520700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.755

Rank 1 · TkA02G594100 · TK1151

Cytoplasm0.296

Rank 2 · TkA02G594100 · TK1151

Mitochondrion0.038

Rank 3 · TkA02G594100 · TK1151

Cell membrane0.028

Rank 4 · TkA02G594100 · TK1151

Endoplasmic reticulum0.025

Rank 5 · TkA02G594100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09731Mitofilin16-125 aa

PF04851ResIII52-52 aa

PF00270DEAD148-325 aa

PF04851ResIII166-292 aa

PF02662FlpD338-379 aa

PF00271Helicase_C367-470 aa

PF26142DD_DDX21-DDX50504-556 aa

PF08152GUCT559-654 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G594100	`PF09731`	Mitofilin	16	125	1.3	8.6
TkA02G594100	`PF04851`	ResIII	52	52	0.0038	17.9
TkA02G594100	`PF00270`	DEAD	148	325	4.1e-40	138.0
TkA02G594100	`PF04851`	ResIII	166	292	0.0038	17.9
TkA02G594100	`PF02662`	FlpD	338	379	0.11	13.2
TkA02G594100	`PF00271`	Helicase_C	367	470	1.6e-26	93.5
TkA02G594100	`PF26142`	DD_DDX21-DDX50	504	556	4.3e-20	72.3
TkA02G594100	`PF08152`	GUCT	559	654	5.4e-29	101.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39189`	Arabidopsis thaliana	sp\|Q39189\|RH7_ARATH DEAD-box ATP-dependent RNA helicase 7	68.800%	Swiss-Prot	High
`Q650T9`	Oryza sativa subsp. japonica	sp\|Q650T9\|RH7_ORYSJ DEAD-box ATP-dependent RNA helicase 7	65.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card